EMAIL THIS PAGE TO A FRIEND

NCMAP

noncompact myelin associated protein

174 Gene Product Result for
Synonyms: C1orf130 MP11
UniProtKB ID: Q5T1S8, A0PK04, B2RV34
Gene ID:
Mouse(230822) noncompact myelin associated protein
Rat(689826) noncompact myelin associated protein
cow(614724) noncompact myelin associated protein
dog(612254) noncompact myelin associated protein
domestic cat(101101650) noncompact myelin associated protein
sheep(101116544) noncompact myelin associated protein
naked mole-rat(101723828) noncompact myelin associated protein
domestic guinea pig(100719045) noncompact myelin associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010980 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010980 Rosetta Predictions human pricing
XM_001072162 Rosetta Predictions rat pricing
NM_145555 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243709 predicted 674
2 SASI_Hs01_00243710 predicted 489
3 SASI_Hs01_00243711 predicted 834
4 SASI_Hs01_00243712 predicted 643
5 SASI_Hs01_00243713 predicted 477
6 SASI_Hs01_00243714 predicted 620
7 SASI_Hs01_00243715 predicted 615
8 SASI_Hs01_00243716 predicted 822
9 SASI_Hs01_00243717 predicted 718
10 SASI_Hs01_00243718 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338068 predicted 277
2 SASI_Rn02_00338069 predicted 282
3 SASI_Rn02_00338070 predicted 196
4 SASI_Rn02_00338071 predicted 267
5 SASI_Rn02_00338072 predicted 216
6 SASI_Rn02_00338073 predicted 594
7 SASI_Rn02_00338074 predicted 315
8 SASI_Rn02_00338075 predicted 717
9 SASI_Rn02_00338076 predicted 496
10 SASI_Rn02_00338077 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200491 predicted 797
2 SASI_Mm01_00200492 predicted 1287
3 SASI_Mm01_00200493 predicted 1442
4 SASI_Mm01_00200494 predicted 1429
5 SASI_Mm02_00341052 predicted 1044
6 SASI_Mm01_00200495 predicted 1206
7 SASI_Mm01_00200496 predicted 1194
8 SASI_Mm01_00200497 predicted 958
9 SASI_Mm01_00200498 predicted 974
10 SASI_Mm01_00200499 predicted 1423
11 SASI_Mm01_00200490 predicted 1207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010980
NCMAP MISSION shRNA Bacterial Glycerol Stock
noncompact myelin associated protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010980.4-225s21c1
Sequence:CCGGATCATCTTCACCGTGGTTCTGCTCGAGCAGAACCACGGTGAAGATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-141s1c1
Sequence:CCGGGTATAAGAGTTCTGGAGCCATCTCGAGATGGCTCCAGAACTCTTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-217s1c1
Sequence:CCGGCTGAAGATGTACAACAGGAAACTCGAGTTTCCTGTTGTACATCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-128s1c1
Sequence:CCGGGAGAAGACTTCCTGTATAAGACTCGAGTCTTATACAGGAAGTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010980.4-513s21c1
Sequence:CCGGAGGTCGACAGAGACATCTTTGCTCGAGCAAAGATGTCTCTGTCGACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010980.4-756s21c1
Sequence:CCGGACTGCTGAGAGTATCACAATACTCGAGTATTGTGATACTCTCAGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010980.4-203s21c1
Sequence:CCGGTGCCGTTGTGGTGGTTGTCATCTCGAGATGACAACCACCACAACGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-216s1c1
Sequence:CCGGGCTGAAGATGTACAACAGGAACTCGAGTTCCTGTTGTACATCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-98s1c1
Sequence:CCGGCCTTCTTCTCACTGAACATGACTCGAGTCATGTTCAGTGAGAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010980.1-2799s1c1
Sequence:CCGGGCCATTTCTTTGAGGGCTCAACTCGAGTTGAGCCCTCAAAGAAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010980
NCMAP MISSION shRNA shRNA Plasmid DNA
noncompact myelin associated protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010980.4-225s21c1
Sequence:CCGGATCATCTTCACCGTGGTTCTGCTCGAGCAGAACCACGGTGAAGATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-141s1c1
Sequence:CCGGGTATAAGAGTTCTGGAGCCATCTCGAGATGGCTCCAGAACTCTTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-217s1c1
Sequence:CCGGCTGAAGATGTACAACAGGAAACTCGAGTTTCCTGTTGTACATCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-128s1c1
Sequence:CCGGGAGAAGACTTCCTGTATAAGACTCGAGTCTTATACAGGAAGTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010980.4-513s21c1
Sequence:CCGGAGGTCGACAGAGACATCTTTGCTCGAGCAAAGATGTCTCTGTCGACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010980.4-756s21c1
Sequence:CCGGACTGCTGAGAGTATCACAATACTCGAGTATTGTGATACTCTCAGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010980.4-203s21c1
Sequence:CCGGTGCCGTTGTGGTGGTTGTCATCTCGAGATGACAACCACCACAACGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-216s1c1
Sequence:CCGGGCTGAAGATGTACAACAGGAACTCGAGTTCCTGTTGTACATCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-98s1c1
Sequence:CCGGCCTTCTTCTCACTGAACATGACTCGAGTCATGTTCAGTGAGAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010980.1-2799s1c1
Sequence:CCGGGCCATTTCTTTGAGGGCTCAACTCGAGTTGAGCCCTCAAAGAAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010980
NCMAP MISSION shRNA Lentiviral Transduction Particles
noncompact myelin associated protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010980.4-225s21c1
Sequence:CCGGATCATCTTCACCGTGGTTCTGCTCGAGCAGAACCACGGTGAAGATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-141s1c1
Sequence:CCGGGTATAAGAGTTCTGGAGCCATCTCGAGATGGCTCCAGAACTCTTATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-217s1c1
Sequence:CCGGCTGAAGATGTACAACAGGAAACTCGAGTTTCCTGTTGTACATCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-128s1c1
Sequence:CCGGGAGAAGACTTCCTGTATAAGACTCGAGTCTTATACAGGAAGTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010980.4-513s21c1
Sequence:CCGGAGGTCGACAGAGACATCTTTGCTCGAGCAAAGATGTCTCTGTCGACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010980.4-756s21c1
Sequence:CCGGACTGCTGAGAGTATCACAATACTCGAGTATTGTGATACTCTCAGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010980.4-203s21c1
Sequence:CCGGTGCCGTTGTGGTGGTTGTCATCTCGAGATGACAACCACCACAACGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-216s1c1
Sequence:CCGGGCTGAAGATGTACAACAGGAACTCGAGTTCCTGTTGTACATCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010980.1-98s1c1
Sequence:CCGGCCTTCTTCTCACTGAACATGACTCGAGTCATGTTCAGTGAGAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010980.1-2799s1c1
Sequence:CCGGGCCATTTCTTTGAGGGCTCAACTCGAGTTGAGCCCTCAAAGAAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145555
NCMAP MISSION shRNA Bacterial Glycerol Stock
noncompact myelin associated protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145555.1-807s1c1
Sequence:CCGGCGTGGTGGTTGTCATCATCATCTCGAGATGATGATGACAACCACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145555.1-1292s21c1
Sequence:CCGGGACGGCTAGACAGCTTGATAGCTCGAGCTATCAAGCTGTCTAGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-734s21c1
Sequence:CCGGCCGTCTTCTCGCTGAACATGACTCGAGTCATGTTCAGCGAGAAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-804s21c1
Sequence:CCGGCATCGTGGTGGTTGTCATCATCTCGAGATGATGACAACCACCACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145555.1-1439s1c1
Sequence:CCGGGAAACTAACTTGGACTAACTACTCGAGTAGTTAGTCCAAGTTAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145555.1-822s1c1
Sequence:CCGGCATCATTGTCACCTTGGTGCTCTCGAGAGCACCAAGGTGACAATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-761s21c1
Sequence:CCGGGAGAGGACGCCCTGTATAAGACTCGAGTCTTATACAGGGCGTCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-843s21c1
Sequence:CCGGGATCCTGCTGAAGATGTACAACTCGAGTTGTACATCTTCAGCAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145555
NCMAP MISSION shRNA shRNA Plasmid DNA
noncompact myelin associated protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145555.1-807s1c1
Sequence:CCGGCGTGGTGGTTGTCATCATCATCTCGAGATGATGATGACAACCACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145555.1-1292s21c1
Sequence:CCGGGACGGCTAGACAGCTTGATAGCTCGAGCTATCAAGCTGTCTAGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-734s21c1
Sequence:CCGGCCGTCTTCTCGCTGAACATGACTCGAGTCATGTTCAGCGAGAAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-804s21c1
Sequence:CCGGCATCGTGGTGGTTGTCATCATCTCGAGATGATGACAACCACCACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145555.1-1439s1c1
Sequence:CCGGGAAACTAACTTGGACTAACTACTCGAGTAGTTAGTCCAAGTTAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145555.1-822s1c1
Sequence:CCGGCATCATTGTCACCTTGGTGCTCTCGAGAGCACCAAGGTGACAATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-761s21c1
Sequence:CCGGGAGAGGACGCCCTGTATAAGACTCGAGTCTTATACAGGGCGTCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-843s21c1
Sequence:CCGGGATCCTGCTGAAGATGTACAACTCGAGTTGTACATCTTCAGCAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145555
NCMAP MISSION shRNA Lentiviral Transduction Particles
noncompact myelin associated protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145555.1-807s1c1
Sequence:CCGGCGTGGTGGTTGTCATCATCATCTCGAGATGATGATGACAACCACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145555.1-1292s21c1
Sequence:CCGGGACGGCTAGACAGCTTGATAGCTCGAGCTATCAAGCTGTCTAGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-734s21c1
Sequence:CCGGCCGTCTTCTCGCTGAACATGACTCGAGTCATGTTCAGCGAGAAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-804s21c1
Sequence:CCGGCATCGTGGTGGTTGTCATCATCTCGAGATGATGACAACCACCACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145555.1-1439s1c1
Sequence:CCGGGAAACTAACTTGGACTAACTACTCGAGTAGTTAGTCCAAGTTAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145555.1-822s1c1
Sequence:CCGGCATCATTGTCACCTTGGTGCTCTCGAGAGCACCAAGGTGACAATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-761s21c1
Sequence:CCGGGAGAGGACGCCCTGTATAAGACTCGAGTCTTATACAGGGCGTCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145555.1-843s21c1
Sequence:CCGGGATCCTGCTGAAGATGTACAACTCGAGTTGTACATCTTCAGCAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)