EMAIL THIS PAGE TO A FRIEND

NCOA2

nuclear receptor coactivator 2

140 Gene Product Result for
Synonyms: GRIP1 KAT13C NCoA-2 SRC2 TIF2 bHLHe75
UniProtKB ID: Q15596, Q14CD2
Gene ID:
Human(10499) Summary: The NCOA2 gene encodes nuclear receptor coactivator 2, which aids in the function of nuclear hormone receptors. Nuclear hormone receptors are conditional transcription factors that play important roles in various aspects of cell growth, development, and homeostasis by controlling expression of specific genes. Members of the nuclear hormone receptor superfamily, which includes the 5 steroid receptors and class II nuclear receptors (see below), are structurally characterized by 3 distinct domains: an N-terminal transcriptional activation domain, a central DNA-binding domain, and a C-terminal hormone-binding domain. Before the binding of hormone, steroid receptors, which are sometimes called class I of the nuclear hormone receptor family, remain inactive in a complex with heat-shock protein-90 (MIM 140571) and other stress family proteins. Binding of hormone induces critical conformational changes in steroid receptors that cause them to dissociate from the inhibitory complex, bind as homodimers to specific DNA enhancer elements associated with target genes, and modulate that gene's transcription. After binding to enhancer elements, transcription factors require transcriptional coactivator proteins to mediate their stimulation of transcription initiation (Hong et al., 1997 [PubMed 9111344]
Mouse(17978) nuclear receptor coactivator 2
Rat(83724) nuclear receptor coactivator 2
sheep(101104249) nuclear receptor coactivator 2
naked mole-rat(101700727) nuclear receptor coactivator 2
domestic guinea pig(100735429) nuclear receptor coactivator 2
Zebrafish(81884) nuclear receptor coactivator 2
dog(486989) nuclear receptor coactivator 2
domestic cat(101094648) nuclear receptor coactivator 2
cow(508162) nuclear receptor coactivator 2
Horse(100051656) nuclear receptor coactivator 2
chicken(420176) nuclear receptor coactivator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700460 Anti-NCOA2 (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA060243 Anti-NCOA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2104470 Anti-NCOA2, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, rat, human, mouse, canine, guinea pig, rabbit, pig, horse
western blot pricing
SAB4504715 Anti-phospho-NCoA2 (pSer736) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
PLA0094 Rabbit anti-SRC2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, gorilla, chimpanzee, human, gibbon, marmoset, rhesus monkey
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006540 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069521 MISSION® esiRNA esiRNA targeting mouse Ncoa2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006540 Rosetta Predictions human pricing
NM_031822 Rosetta Predictions rat pricing
NM_001077695 Rosetta Predictions mouse pricing
NM_008678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341797 predicted 3790
2 SASI_Hs01_00110929 predicted 577
3 SASI_Hs02_00341798 predicted 1297
4 SASI_Hs01_00110934 predicted 3762
5 SASI_Hs01_00110935 predicted 3594
6 SASI_Hs02_00341799 predicted 3232
7 SASI_Hs01_00110936 predicted 4487
8 SASI_Hs01_00110937 predicted 2379
9 SASI_Hs01_00110938 predicted 2418
10 SASI_Hs02_00341800 predicted 3573
11 SASI_Hs01_00110930 predicted 432
12 SASI_Hs01_00110931 predicted 4504
13 SASI_Hs01_00110932 predicted 455
14 SASI_Hs01_00110933 predicted 3181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110118 predicted 2134
2 SASI_Rn01_00110120 predicted 3113
3 SASI_Rn01_00110121 predicted 3552
4 SASI_Rn01_00110122 predicted 3433
5 SASI_Rn01_00110123 predicted 2811
6 SASI_Rn02_00265295 predicted 1343
7 SASI_Rn01_00110124 predicted 3244
8 SASI_Rn01_00110125 predicted 2252
9 SASI_Rn01_00110126 predicted 3900
10 SASI_Rn01_00110127 predicted 712
11 SASI_Rn01_00110119 predicted 2586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292892 predicted 3913
2 SASI_Mm02_00292893 predicted 1460
3 SASI_Mm02_00292894 predicted 4409
4 SASI_Mm02_00292895 predicted 491
5 SASI_Mm02_00292896 predicted 3259
6 SASI_Mm02_00292897 predicted 1398
7 SASI_Mm02_00292898 predicted 2472
8 SASI_Mm02_00292899 predicted 1353
9 SASI_Mm02_00292900 predicted 3023
10 SASI_Mm02_00292901 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172093 predicted 4116
2 SASI_Mm01_00172094 predicted 1465
3 SASI_Mm02_00314450 predicted 4611
4 SASI_Mm01_00172095 predicted 490
5 SASI_Mm01_00172096 predicted 3468
6 SASI_Mm01_00172097 predicted 1396
7 SASI_Mm01_00172098 predicted 2474
8 SASI_Mm02_00314451 predicted 1362
9 SASI_Mm01_00172099 predicted 3236
10 SASI_Mm01_00172100 predicted 637
11 SASI_Mm01_00172092 predicted 630
12 SASI_Mm01_00172101 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006540
VALIDATED
NCOA2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-1193s1c1
Sequence:CCGGGCACTCTTGTTGCTGCACAAACTCGAGTTTGTGCAGCAACAAGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-4500s1c1
Sequence:CCGGGCTGCCTGGAATGGATATGATCTCGAGATCATATCCATTCCAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-2911s1c1
Sequence:CCGGCCAGGAATGATGGGTAATCAACTCGAGTTGATTACCCATCATTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006540.1-361s1c1
Sequence:CCGGCCTGACAAATGTGCAATCTTACTCGAGTAAGATTGCACATTTGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-1727s1c1
Sequence:CCGGGCACAGGAAATAGCCATAGTTCTCGAGAACTATGGCTATTTCCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-1193s21c1
Sequence:CCGGGCACTCTTGTTGCTGCACAAACTCGAGTTTGTGCAGCAACAAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-2395s21c1
Sequence:CCGGCTTCGCTATTTGCTAGATAAACTCGAGTTTATCTAGCAAATAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-4796s21c1
Sequence:CCGGATTCACCTTAGTGCAACTTAGCTCGAGCTAAGTTGCACTAAGGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-1727s21c1
Sequence:CCGGGCACAGGAAATAGCCATAGTTCTCGAGAACTATGGCTATTTCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-1228s21c1
Sequence:CCGGATCCGTTCTCAGACTACTAATCTCGAGATTAGTAGTCTGAGAACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006540
VALIDATED
NCOA2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-1193s1c1
Sequence:CCGGGCACTCTTGTTGCTGCACAAACTCGAGTTTGTGCAGCAACAAGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-4500s1c1
Sequence:CCGGGCTGCCTGGAATGGATATGATCTCGAGATCATATCCATTCCAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-2911s1c1
Sequence:CCGGCCAGGAATGATGGGTAATCAACTCGAGTTGATTACCCATCATTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006540.1-361s1c1
Sequence:CCGGCCTGACAAATGTGCAATCTTACTCGAGTAAGATTGCACATTTGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-1727s1c1
Sequence:CCGGGCACAGGAAATAGCCATAGTTCTCGAGAACTATGGCTATTTCCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-1193s21c1
Sequence:CCGGGCACTCTTGTTGCTGCACAAACTCGAGTTTGTGCAGCAACAAGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-2395s21c1
Sequence:CCGGCTTCGCTATTTGCTAGATAAACTCGAGTTTATCTAGCAAATAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-4796s21c1
Sequence:CCGGATTCACCTTAGTGCAACTTAGCTCGAGCTAAGTTGCACTAAGGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-1727s21c1
Sequence:CCGGGCACAGGAAATAGCCATAGTTCTCGAGAACTATGGCTATTTCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-1228s21c1
Sequence:CCGGATCCGTTCTCAGACTACTAATCTCGAGATTAGTAGTCTGAGAACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006540
VALIDATED
NCOA2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-1193s1c1
Sequence:CCGGGCACTCTTGTTGCTGCACAAACTCGAGTTTGTGCAGCAACAAGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-4500s1c1
Sequence:CCGGGCTGCCTGGAATGGATATGATCTCGAGATCATATCCATTCCAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-2911s1c1
Sequence:CCGGCCAGGAATGATGGGTAATCAACTCGAGTTGATTACCCATCATTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006540.1-361s1c1
Sequence:CCGGCCTGACAAATGTGCAATCTTACTCGAGTAAGATTGCACATTTGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006540.1-1727s1c1
Sequence:CCGGGCACAGGAAATAGCCATAGTTCTCGAGAACTATGGCTATTTCCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-1193s21c1
Sequence:CCGGGCACTCTTGTTGCTGCACAAACTCGAGTTTGTGCAGCAACAAGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-2395s21c1
Sequence:CCGGCTTCGCTATTTGCTAGATAAACTCGAGTTTATCTAGCAAATAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-4796s21c1
Sequence:CCGGATTCACCTTAGTGCAACTTAGCTCGAGCTAAGTTGCACTAAGGTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-1727s21c1
Sequence:CCGGGCACAGGAAATAGCCATAGTTCTCGAGAACTATGGCTATTTCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006540.2-1228s21c1
Sequence:CCGGATCCGTTCTCAGACTACTAATCTCGAGATTAGTAGTCTGAGAACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008678
VALIDATED
NCOA2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008678.1-704s1c1
Sequence:CCGGCCACACTGAATTTGTCAAGAACTCGAGTTCTTGACAAATTCAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008678.1-4625s1c1
Sequence:CCGGCCACTGGGCTTACAAACATTTCTCGAGAAATGTTTGTAAGCCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008678.1-1780s1c1
Sequence:CCGGGCCATAGTTATACCAACAGTTCTCGAGAACTGTTGGTATAACTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008678.1-2436s1c1
Sequence:CCGGCTGCGCTATTTGCTCGACAAACTCGAGTTTGTCGAGCAAATAGCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008678.1-3233s1c1
Sequence:CCGGCCCTTCTGAGTTAGAGATGAACTCGAGTTCATCTCTAACTCAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-2489s21c1
Sequence:CCGGATATTGGTTTACCGGAAATAACTCGAGTTATTTCCGGTAAACCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-3894s21c1
Sequence:CCGGGCCCACTCAGGCTCCTATTAACTCGAGTTAATAGGAGCCTGAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-1470s21c1
Sequence:CCGGCATGACCCTCGGTAGCAATATCTCGAGATATTGCTACCGAGGGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-1288s21c1
Sequence:CCGGATCCGTTCTCAGACTACTAATCTCGAGATTAGTAGTCTGAGAACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008678
VALIDATED
NCOA2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008678.1-704s1c1
Sequence:CCGGCCACACTGAATTTGTCAAGAACTCGAGTTCTTGACAAATTCAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008678.1-4625s1c1
Sequence:CCGGCCACTGGGCTTACAAACATTTCTCGAGAAATGTTTGTAAGCCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008678.1-1780s1c1
Sequence:CCGGGCCATAGTTATACCAACAGTTCTCGAGAACTGTTGGTATAACTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008678.1-2436s1c1
Sequence:CCGGCTGCGCTATTTGCTCGACAAACTCGAGTTTGTCGAGCAAATAGCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008678.1-3233s1c1
Sequence:CCGGCCCTTCTGAGTTAGAGATGAACTCGAGTTCATCTCTAACTCAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-2489s21c1
Sequence:CCGGATATTGGTTTACCGGAAATAACTCGAGTTATTTCCGGTAAACCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-3894s21c1
Sequence:CCGGGCCCACTCAGGCTCCTATTAACTCGAGTTAATAGGAGCCTGAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-1470s21c1
Sequence:CCGGCATGACCCTCGGTAGCAATATCTCGAGATATTGCTACCGAGGGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-1288s21c1
Sequence:CCGGATCCGTTCTCAGACTACTAATCTCGAGATTAGTAGTCTGAGAACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008678
VALIDATED
NCOA2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008678.1-704s1c1
Sequence:CCGGCCACACTGAATTTGTCAAGAACTCGAGTTCTTGACAAATTCAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008678.1-4625s1c1
Sequence:CCGGCCACTGGGCTTACAAACATTTCTCGAGAAATGTTTGTAAGCCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008678.1-1780s1c1
Sequence:CCGGGCCATAGTTATACCAACAGTTCTCGAGAACTGTTGGTATAACTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008678.1-2436s1c1
Sequence:CCGGCTGCGCTATTTGCTCGACAAACTCGAGTTTGTCGAGCAAATAGCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008678.1-3233s1c1
Sequence:CCGGCCCTTCTGAGTTAGAGATGAACTCGAGTTCATCTCTAACTCAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-2489s21c1
Sequence:CCGGATATTGGTTTACCGGAAATAACTCGAGTTATTTCCGGTAAACCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-3894s21c1
Sequence:CCGGGCCCACTCAGGCTCCTATTAACTCGAGTTAATAGGAGCCTGAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-1470s21c1
Sequence:CCGGCATGACCCTCGGTAGCAATATCTCGAGATATTGCTACCGAGGGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008678.2-1288s21c1
Sequence:CCGGATCCGTTCTCAGACTACTAATCTCGAGATTAGTAGTCTGAGAACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)