EMAIL THIS PAGE TO A FRIEND

NCOA3

nuclear receptor coactivator 3

130 Gene Product Result for
Synonyms: ACTR AIB-1 AIB1 CAGH16 CTG26 KAT13B RAC3 SRC-3 SRC3 TNRC14 TNRC16 TRAM-1 bHLHe42 pCIP
Gene ID:
Human(8202) Summary: The protein encoded by this gene is a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activator functions. The encoded protein has histone acetyltransferase activity and recruits p300/CBP-associated factor and CREB binding protein as part of a multisubunit coactivation complex. This protein is initially found in the cytoplasm but is translocated into the nucleus upon phosphorylation. Several transcript variants encoding different isoforms have been found for this gene. In addition, a polymorphic repeat region is found in the C-terminus of the encoded protein. [provided by RefSeq, Mar 2010]
Mouse(17979) nuclear receptor coactivator 3
Rat(84584) nuclear receptor coactivator 3
Zebrafish(564519) nuclear receptor coactivator 3
cow(523707) nuclear receptor coactivator 3
Horse(100071296) nuclear receptor coactivator 3
domestic cat(101083330) nuclear receptor coactivator 3
dog(485915) nuclear receptor coactivator 3
chicken(419208) nuclear receptor coactivator 3
domestic guinea pig(100732095) nuclear receptor coactivator 3
naked mole-rat(101708253) nuclear receptor coactivator 3
sheep(101119237) nuclear receptor coactivator 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006534 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006534 Rosetta Predictions human pricing
NM_181659 Rosetta Predictions human pricing
XM_001072953 Rosetta Predictions rat pricing
XM_215947 Rosetta Predictions rat pricing
NM_008679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341782 predicted 1002
2 SASI_Hs01_00063434 predicted 1627
3 SASI_Hs01_00063435 predicted 2607
4 SASI_Hs01_00063436 predicted 2101
5 SASI_Hs01_00063437 predicted 917
6 SASI_Hs01_00063438 predicted 347
7 SASI_Hs01_00063439 predicted 3297
8 SASI_Hs02_00341783 predicted 2441
9 SASI_Hs01_00063440 predicted 2698
10 SASI_Hs02_00341784 predicted 587
11 SASI_Hs01_00063433 predicted 1025
12 SASI_Hs01_00063441 predicted 3455
13 SASI_Hs01_00063442 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370252 predicted 1004
2 SASI_Hs01_00123250 predicted 1623
3 SASI_Hs01_00123251 predicted 2602
4 SASI_Hs01_00123252 predicted 2095
5 SASI_Hs01_00123253 predicted 917
6 SASI_Hs01_00123254 predicted 354
7 SASI_Hs01_00123255 predicted 3295
8 SASI_Hs02_00370253 predicted 2436
9 SASI_Hs01_00123256 predicted 2695
10 SASI_Hs02_00370254 predicted 581
11 SASI_Hs01_00123249 predicted 1033
12 SASI_Hs01_00123257 predicted 3454
13 SASI_Hs01_00123258 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341081 predicted 2579
2 SASI_Rn02_00341082 predicted 1039
3 SASI_Rn02_00341083 predicted 1153
4 SASI_Rn02_00341084 predicted 1219
5 SASI_Rn02_00341085 predicted 4112
6 SASI_Rn02_00341086 predicted 675
7 SASI_Rn02_00341087 predicted 2613
8 SASI_Rn02_00341088 predicted 2380
9 SASI_Rn02_00341089 predicted 1093
10 SASI_Rn02_00341090 predicted 3546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376316 predicted 2588
2 SASI_Rn02_00376317 predicted 1038
3 SASI_Rn02_00376318 predicted 1151
4 SASI_Rn02_00376319 predicted 1212
5 SASI_Rn02_00376320 predicted 4106
6 SASI_Rn02_00376321 predicted 669
7 SASI_Rn02_00376322 predicted 2617
8 SASI_Rn02_00376323 predicted 2375
9 SASI_Rn02_00376324 predicted 1097
10 SASI_Rn02_00376325 predicted 3549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107066 predicted 1050
2 SASI_Mm01_00107068 predicted 683
3 SASI_Mm01_00107067 predicted 1029
4 SASI_Mm01_00107070 predicted 1225
5 SASI_Mm02_00314452 predicted 2670
6 SASI_Mm01_00107071 predicted 1017
7 SASI_Mm01_00107072 predicted 1272
8 SASI_Mm01_00107073 predicted 2619
9 SASI_Mm01_00107074 predicted 1083
10 SASI_Mm01_00107075 predicted 2131
11 SASI_Mm01_00107069 predicted 1734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006534
VALIDATED
NCOA3 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-510s21c1
Sequence:CCGGCTACAGGGCAGGGAGTTATTGCTCGAGCAATAACTCCCTGCCCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-430s21c1
Sequence:CCGGAGTAAGACAGATACGTCAAATCTCGAGATTTGACGTATCTGTCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-4717s21c1
Sequence:CCGGTTCCACCTCCTAGGGATATAACTCGAGTTATATCCCTAGGAGGTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-3084s21c1
Sequence:CCGGCATTGCCTCTTCGGTCTAATACTCGAGTATTAGACCGAAGAGGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-957s1c1
Sequence:CCGGGCCGCATTACTACAGGAGAAACTCGAGTTTCTCCTGTAGTAATGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.06 Cell Line: A549
TRC Version: 1 Clone ID:NM_006534.2-2187s1c1
Sequence:CCGGCCTCTACATCTGGAGGAGTATCTCGAGATACTCCTCCAGATGTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-3517s21c1
Sequence:CCGGGGATCAGAAGGCAGGATTATACTCGAGTATAATCCTGCCTTCTGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-4106s1c1
Sequence:CCGGCCTCCGCAACAGTTTCCATATCTCGAGATATGGAAACTGTTGCGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-2740s1c1
Sequence:CCGGGCAGTCTATTCGTCCTCCATACTCGAGTATGGAGGACGAATAGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-781s1c1
Sequence:CCGGCCATACATTTAATTGCCGTATCTCGAGATACGGCAATTAAATGTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-4510s21c1
Sequence:CCGGTGACACTGCACTAGGATTATTCTCGAGAATAATCCTAGTGCAGTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006534
VALIDATED
NCOA3 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-510s21c1
Sequence:CCGGCTACAGGGCAGGGAGTTATTGCTCGAGCAATAACTCCCTGCCCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-430s21c1
Sequence:CCGGAGTAAGACAGATACGTCAAATCTCGAGATTTGACGTATCTGTCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-4717s21c1
Sequence:CCGGTTCCACCTCCTAGGGATATAACTCGAGTTATATCCCTAGGAGGTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-3084s21c1
Sequence:CCGGCATTGCCTCTTCGGTCTAATACTCGAGTATTAGACCGAAGAGGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-957s1c1
Sequence:CCGGGCCGCATTACTACAGGAGAAACTCGAGTTTCTCCTGTAGTAATGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.06 Cell Line: A549
TRC Version: 1 Clone ID:NM_006534.2-2187s1c1
Sequence:CCGGCCTCTACATCTGGAGGAGTATCTCGAGATACTCCTCCAGATGTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-3517s21c1
Sequence:CCGGGGATCAGAAGGCAGGATTATACTCGAGTATAATCCTGCCTTCTGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-4106s1c1
Sequence:CCGGCCTCCGCAACAGTTTCCATATCTCGAGATATGGAAACTGTTGCGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-2740s1c1
Sequence:CCGGGCAGTCTATTCGTCCTCCATACTCGAGTATGGAGGACGAATAGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-781s1c1
Sequence:CCGGCCATACATTTAATTGCCGTATCTCGAGATACGGCAATTAAATGTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-4510s21c1
Sequence:CCGGTGACACTGCACTAGGATTATTCTCGAGAATAATCCTAGTGCAGTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006534
VALIDATED
NCOA3 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-510s21c1
Sequence:CCGGCTACAGGGCAGGGAGTTATTGCTCGAGCAATAACTCCCTGCCCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-430s21c1
Sequence:CCGGAGTAAGACAGATACGTCAAATCTCGAGATTTGACGTATCTGTCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-4717s21c1
Sequence:CCGGTTCCACCTCCTAGGGATATAACTCGAGTTATATCCCTAGGAGGTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-3084s21c1
Sequence:CCGGCATTGCCTCTTCGGTCTAATACTCGAGTATTAGACCGAAGAGGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-957s1c1
Sequence:CCGGGCCGCATTACTACAGGAGAAACTCGAGTTTCTCCTGTAGTAATGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.06 Cell Line: A549
TRC Version: 1 Clone ID:NM_006534.2-2187s1c1
Sequence:CCGGCCTCTACATCTGGAGGAGTATCTCGAGATACTCCTCCAGATGTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-3517s21c1
Sequence:CCGGGGATCAGAAGGCAGGATTATACTCGAGTATAATCCTGCCTTCTGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-4106s1c1
Sequence:CCGGCCTCCGCAACAGTTTCCATATCTCGAGATATGGAAACTGTTGCGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-2740s1c1
Sequence:CCGGGCAGTCTATTCGTCCTCCATACTCGAGTATGGAGGACGAATAGACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006534.2-781s1c1
Sequence:CCGGCCATACATTTAATTGCCGTATCTCGAGATACGGCAATTAAATGTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_006534.2-4510s21c1
Sequence:CCGGTGACACTGCACTAGGATTATTCTCGAGAATAATCCTAGTGCAGTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008679
NCOA3 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-1729s1c1
Sequence:CCGGACTGGATAATTCTCCCAATATCTCGAGATATTGGGAGAATTATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008679.1-4373s1c1
Sequence:CCGGCATTGTCTAAGCATCCAGCTTCTCGAGAAGCTGGATGCTTAGACAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-3692s1c1
Sequence:CCGGCGGCAGGCACTTGAAATGAAACTCGAGTTTCATTTCAAGTGCCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-2903s1c1
Sequence:CCGGGCCGATTACAGTGCCACTTTACTCGAGTAAAGTGGCACTGTAATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-638s1c1
Sequence:CCGGCCACAGTTAATGGAGTTTCTTCTCGAGAAGAAACTCCATTAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008679
NCOA3 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-1729s1c1
Sequence:CCGGACTGGATAATTCTCCCAATATCTCGAGATATTGGGAGAATTATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008679.1-4373s1c1
Sequence:CCGGCATTGTCTAAGCATCCAGCTTCTCGAGAAGCTGGATGCTTAGACAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-3692s1c1
Sequence:CCGGCGGCAGGCACTTGAAATGAAACTCGAGTTTCATTTCAAGTGCCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-2903s1c1
Sequence:CCGGGCCGATTACAGTGCCACTTTACTCGAGTAAAGTGGCACTGTAATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-638s1c1
Sequence:CCGGCCACAGTTAATGGAGTTTCTTCTCGAGAAGAAACTCCATTAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008679
NCOA3 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-1729s1c1
Sequence:CCGGACTGGATAATTCTCCCAATATCTCGAGATATTGGGAGAATTATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008679.1-4373s1c1
Sequence:CCGGCATTGTCTAAGCATCCAGCTTCTCGAGAAGCTGGATGCTTAGACAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-3692s1c1
Sequence:CCGGCGGCAGGCACTTGAAATGAAACTCGAGTTTCATTTCAAGTGCCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-2903s1c1
Sequence:CCGGGCCGATTACAGTGCCACTTTACTCGAGTAAAGTGGCACTGTAATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008679.1-638s1c1
Sequence:CCGGCCACAGTTAATGGAGTTTCTTCTCGAGAAGAAACTCCATTAACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)