EMAIL THIS PAGE TO A FRIEND

NCOA4

nuclear receptor coactivator 4

87 Gene Product Result for
Synonyms: ARA70 ELE1 PTC3 RFG
UniProtKB ID: Q13772, A8K8W5, B4E260, E9PAV7, J3KQN8, Q14239
Gene ID:
Human(8031) Summary: This gene encodes an androgen receptor coactivator. The encoded protein interacts with the androgen receptor in a ligand-dependent manner to enhance its transcriptional activity. Chromosomal translocations between this gene and the ret tyrosine kinase gene, also located on chromosome 10, have been associated with papillary thyroid carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes are present on chromosomes 4, 5, 10, and 14. [provided by RefSeq, Feb 2009]
Mouse(27057) nuclear receptor coactivator 4
Rat(619385) nuclear receptor coactivator 4
sheep(101119108) nuclear receptor coactivator 4
naked mole-rat(101707977) nuclear receptor coactivator 4
Domestic Rabbit(100342735) nuclear receptor coactivator 4
domestic guinea pig(100719762) nuclear receptor coactivator 4
Zebrafish(394104) nuclear receptor coactivator 4
cow(525329) nuclear receptor coactivator 4
Horse(100062485) nuclear receptor coactivator 4
domestic cat(101094542) nuclear receptor coactivator 4
dog(477750) nuclear receptor coactivator 4
chicken(423615) nuclear receptor coactivator 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
N3664 Anti-NCOA4 (466-480) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
N3789 Anti-NCOA4 (600-614) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2108396 Anti-NCOA4 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, human, mouse, horse
western blot pricing
HPA065208 Anti-NCOA4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106415 Anti-NCOA4 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, horse, rabbit, mouse
ELISA, western blot pricing
HPA051260 Anti-NCOA4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0008031M1 Monoclonal Anti-NCOA4 antibody produced in mouse clone 2H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409835 Monoclonal Anti-NCOA4 antibody produced in mouse clone 1A2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409836 Monoclonal Anti-NCOA4 antibody produced in mouse clone 1E5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409837 Monoclonal Anti-NCOA4 antibody produced in mouse clone 1B7, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunofluorescence, western blot pricing
SAB1409838 Monoclonal Anti-NCOA4 antibody produced in mouse clone 1A2, ascites fluid, solution human
ELISA, western blot pricing
SAB1404569 Monoclonal Anti-NCOA4, (C-terminal) antibody produced in mouse clone 1F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005437 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005437 Rosetta Predictions human pricing
NM_001034007 Rosetta Predictions rat pricing
NM_001034008 Rosetta Predictions rat pricing
NM_001033988 Rosetta Predictions mouse pricing
NM_019744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062462 predicted 1032
2 SASI_Hs01_00062463 predicted 1944
3 SASI_Hs01_00062464 predicted 415
4 SASI_Hs01_00062465 predicted 1558
5 SASI_Hs01_00062466 predicted 1857
6 SASI_Hs01_00062468 predicted 469
7 SASI_Hs01_00062469 predicted 283
8 SASI_Hs02_00339590 predicted 1201
9 SASI_Hs02_00339591 predicted 715
10 SASI_Hs02_00339592 predicted 1661
11 SASI_Hs01_00062467 predicted 1931
12 SASI_Hs01_00062470 predicted 1291
13 SASI_Hs01_00062471 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042709 predicted 425
2 SASI_Rn01_00042710 predicted 653
3 SASI_Rn01_00042711 predicted 1033
4 SASI_Rn01_00042712 predicted 436
5 SASI_Rn01_00042713 predicted 1544
6 SASI_Rn01_00042714 predicted 1859
7 SASI_Rn02_00203884 predicted 1098
8 SASI_Rn01_00042715 predicted 1625
9 SASI_Rn01_00042716 predicted 1461
10 SASI_Rn02_00203885 predicted 803
11 SASI_Rn01_00042717 predicted 1078
12 SASI_Rn01_00042718 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095835 predicted 474
2 SASI_Rn01_00095836 predicted 701
3 SASI_Rn01_00095837 predicted 1079
4 SASI_Rn01_00095838 predicted 482
5 SASI_Rn01_00095839 predicted 1593
6 SASI_Rn01_00095840 predicted 1907
7 SASI_Rn01_00095841 predicted 1670
8 SASI_Rn01_00095842 predicted 1504
9 SASI_Rn02_00203886 predicted 843
10 SASI_Rn01_00095843 predicted 1120
11 SASI_Rn01_00095844 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048903 predicted 1112
2 SASI_Mm01_00048905 predicted 405
3 SASI_Mm01_00048906 predicted 2043
4 SASI_Mm01_00048907 predicted 881
5 SASI_Mm01_00048908 predicted 1167
6 SASI_Mm01_00048909 predicted 648
7 SASI_Mm01_00048910 predicted 454
8 SASI_Mm01_00048911 predicted 1482
9 SASI_Mm01_00048912 predicted 544
10 SASI_Mm02_00289071 predicted 1913
11 SASI_Mm01_00048904 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112990 predicted 1028
2 SASI_Mm01_00112992 predicted 324
3 SASI_Mm01_00112993 predicted 1954
4 SASI_Mm01_00112994 predicted 797
5 SASI_Mm01_00112995 predicted 1079
6 SASI_Mm01_00112996 predicted 564
7 SASI_Mm01_00112997 predicted 366
8 SASI_Mm01_00112998 predicted 1386
9 SASI_Mm01_00112999 predicted 458
10 SASI_Mm02_00324897 predicted 1818
11 SASI_Mm01_00112991 predicted 1268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005437
VALIDATED
NCOA4 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-1834s1c1
Sequence:CCGGCCCAGGAAGTATTACTTAATTCTCGAGAATTAAGTAATACTTCCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-1496s1c1
Sequence:CCGGGCATAAAGATTCCCTGAATATCTCGAGATATTCAGGGAATCTTTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-245s1c1
Sequence:CCGGCCGGGCTGAACAGCAAATTAACTCGAGTTAATTTGCTGTTCAGCCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-1692s1c1
Sequence:CCGGGCTGGCAAACAGAAGTTTAAACTCGAGTTTAAACTTCTGTTTGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-336s1c1
Sequence:CCGGCGTGAGGTATGGCTGTATGAACTCGAGTTCATACAGCCATACCTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-2324s21c1
Sequence:CCGGACTCTTGTTTATCGAAGTATACTCGAGTATACTTCGATAAACAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-407s21c1
Sequence:CCGGTCAGCAGCTCTACTCGTTATTCTCGAGAATAACGAGTAGAGCTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-353s21c1
Sequence:CCGGTGAACAGGTGGACCTTATTTACTCGAGTAAATAAGGTCCACCTGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-1128s21c1
Sequence:CCGGCTCTTATTCCAGTCCTATAATCTCGAGATTATAGGACTGGAATAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005437
VALIDATED
NCOA4 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-1834s1c1
Sequence:CCGGCCCAGGAAGTATTACTTAATTCTCGAGAATTAAGTAATACTTCCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-1496s1c1
Sequence:CCGGGCATAAAGATTCCCTGAATATCTCGAGATATTCAGGGAATCTTTATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-245s1c1
Sequence:CCGGCCGGGCTGAACAGCAAATTAACTCGAGTTAATTTGCTGTTCAGCCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-1692s1c1
Sequence:CCGGGCTGGCAAACAGAAGTTTAAACTCGAGTTTAAACTTCTGTTTGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-336s1c1
Sequence:CCGGCGTGAGGTATGGCTGTATGAACTCGAGTTCATACAGCCATACCTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-2324s21c1
Sequence:CCGGACTCTTGTTTATCGAAGTATACTCGAGTATACTTCGATAAACAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-407s21c1
Sequence:CCGGTCAGCAGCTCTACTCGTTATTCTCGAGAATAACGAGTAGAGCTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-353s21c1
Sequence:CCGGTGAACAGGTGGACCTTATTTACTCGAGTAAATAAGGTCCACCTGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-1128s21c1
Sequence:CCGGCTCTTATTCCAGTCCTATAATCTCGAGATTATAGGACTGGAATAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005437
VALIDATED
NCOA4 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-1834s1c1
Sequence:CCGGCCCAGGAAGTATTACTTAATTCTCGAGAATTAAGTAATACTTCCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-1496s1c1
Sequence:CCGGGCATAAAGATTCCCTGAATATCTCGAGATATTCAGGGAATCTTTATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-245s1c1
Sequence:CCGGCCGGGCTGAACAGCAAATTAACTCGAGTTAATTTGCTGTTCAGCCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-1692s1c1
Sequence:CCGGGCTGGCAAACAGAAGTTTAAACTCGAGTTTAAACTTCTGTTTGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005437.1-336s1c1
Sequence:CCGGCGTGAGGTATGGCTGTATGAACTCGAGTTCATACAGCCATACCTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-2324s21c1
Sequence:CCGGACTCTTGTTTATCGAAGTATACTCGAGTATACTTCGATAAACAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-407s21c1
Sequence:CCGGTCAGCAGCTCTACTCGTTATTCTCGAGAATAACGAGTAGAGCTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-353s21c1
Sequence:CCGGTGAACAGGTGGACCTTATTTACTCGAGTAAATAAGGTCCACCTGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005437.2-1128s21c1
Sequence:CCGGCTCTTATTCCAGTCCTATAATCTCGAGATTATAGGACTGGAATAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019744
VALIDATED
NCOA4 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019744.1-1542s1c1
Sequence:CCGGCGTCATAAAGAATAGTTCCTTCTCGAGAAGGAACTATTCTTTATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019744.1-558s1c1
Sequence:CCGGCTCCTCAAGTATTGGGCCTTTCTCGAGAAAGGCCCAATACTTGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019744.1-151s1c1
Sequence:CCGGCGGGCTGAACAGCAAATTAAACTCGAGTTTAATTTGCTGTTCAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019744.1-267s1c1
Sequence:CCGGCGATCTCATCTATCAGCTTAACTCGAGTTAAGCTGATAGATGAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019744.1-557s1c1
Sequence:CCGGGCTCCTCAAGTATTGGGCCTTCTCGAGAAGGCCCAATACTTGAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019744
VALIDATED
NCOA4 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019744.1-1542s1c1
Sequence:CCGGCGTCATAAAGAATAGTTCCTTCTCGAGAAGGAACTATTCTTTATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019744.1-558s1c1
Sequence:CCGGCTCCTCAAGTATTGGGCCTTTCTCGAGAAAGGCCCAATACTTGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019744.1-151s1c1
Sequence:CCGGCGGGCTGAACAGCAAATTAAACTCGAGTTTAATTTGCTGTTCAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019744.1-267s1c1
Sequence:CCGGCGATCTCATCTATCAGCTTAACTCGAGTTAAGCTGATAGATGAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019744.1-557s1c1
Sequence:CCGGGCTCCTCAAGTATTGGGCCTTCTCGAGAAGGCCCAATACTTGAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019744
VALIDATED
NCOA4 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019744.1-1542s1c1
Sequence:CCGGCGTCATAAAGAATAGTTCCTTCTCGAGAAGGAACTATTCTTTATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019744.1-558s1c1
Sequence:CCGGCTCCTCAAGTATTGGGCCTTTCTCGAGAAAGGCCCAATACTTGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019744.1-151s1c1
Sequence:CCGGCGGGCTGAACAGCAAATTAAACTCGAGTTTAATTTGCTGTTCAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019744.1-267s1c1
Sequence:CCGGCGATCTCATCTATCAGCTTAACTCGAGTTAAGCTGATAGATGAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019744.1-557s1c1
Sequence:CCGGGCTCCTCAAGTATTGGGCCTTCTCGAGAAGGCCCAATACTTGAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)