EMAIL THIS PAGE TO A FRIEND

NCOA6

nuclear receptor coactivator 6

174 Gene Product Result for
Synonyms: AIB3 ASC2 NRC PRIP RAP250 TRBP
Gene ID:
Human(23054) Summary: The protein encoded by this gene is a transcriptional coactivator that can interact with nuclear hormone receptors to enhance their transcriptional activator functions. This protein has been shown to be involved in the hormone-dependent coactivation of several receptors, including prostanoid, retinoid, vitamin D3, thyroid hormone, and steroid receptors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2011]
Mouse(56406) nuclear receptor coactivator 6
Rat(116464) nuclear receptor coactivator 6
sheep(101113427) nuclear receptor coactivator 6
naked mole-rat(101706733) nuclear receptor coactivator 6
Domestic Rabbit(100356436) nuclear receptor coactivator 6
domestic guinea pig(100730344) nuclear receptor coactivator 6
fruit fly(33761) CG14023 gene product from transcript CG14023-RD
Zebrafish(100144559) nuclear receptor coactivator 6
dog(477202) nuclear receptor coactivator 6
cow(508899) nuclear receptor coactivator 6
Horse(100054476) nuclear receptor coactivator 6
chicken(419122) nuclear receptor coactivator 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014071 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014071 Rosetta Predictions human pricing
XM_001064071 Rosetta Predictions rat pricing
XM_001064189 Rosetta Predictions rat pricing
XM_342552 Rosetta Predictions rat pricing
NM_019825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025355 predicted 841
2 SASI_Hs01_00025356 predicted 5676
3 SASI_Hs01_00025357 predicted 4862
4 SASI_Hs01_00025359 predicted 6119
5 SASI_Hs01_00025360 predicted 2460
6 SASI_Hs01_00025361 predicted 4400
7 SASI_Hs01_00025362 predicted 6050
8 SASI_Hs01_00025363 predicted 6021
9 SASI_Hs01_00025364 predicted 4397
10 SASI_Hs02_00345104 predicted 5052
11 SASI_Hs01_00025358 predicted 5418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309242 predicted 2454
2 SASI_Rn02_00309243 predicted 1961
3 SASI_Rn02_00309244 predicted 5295
4 SASI_Rn02_00309245 predicted 5905
5 SASI_Rn02_00309246 predicted 5934
6 SASI_Rn02_00309247 predicted 3644
7 SASI_Rn02_00309248 predicted 5294
8 SASI_Rn02_00309249 predicted 4686
9 SASI_Rn02_00309250 predicted 3956
10 SASI_Rn02_00309251 predicted 4861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309619 predicted 5998
2 SASI_Rn02_00309620 predicted 2456
3 SASI_Rn02_00309621 predicted 1953
4 SASI_Rn02_00309622 predicted 5287
5 SASI_Rn02_00309623 predicted 5907
6 SASI_Rn02_00309624 predicted 3643
7 SASI_Rn02_00309625 predicted 5299
8 SASI_Rn02_00309626 predicted 4684
9 SASI_Rn02_00309627 predicted 4867
10 SASI_Rn02_00309628 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394469 predicted 2548
2 SASI_Rn02_00394470 predicted 2042
3 SASI_Rn02_00394471 predicted 5373
4 SASI_Rn02_00394472 predicted 5997
5 SASI_Rn02_00394473 predicted 6024
6 SASI_Rn02_00394474 predicted 3722
7 SASI_Rn02_00394475 predicted 5385
8 SASI_Rn02_00394476 predicted 4776
9 SASI_Rn02_00394477 predicted 4049
10 SASI_Rn02_00394478 predicted 4944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325117 predicted 5248
2 SASI_Mm01_00040572 predicted 5859
3 SASI_Mm01_00040573 predicted 347
4 SASI_Mm01_00040574 predicted 5137
5 SASI_Mm01_00040575 predicted 2408
6 SASI_Mm01_00040576 predicted 5890
7 SASI_Mm01_00040578 predicted 5959
8 SASI_Mm01_00040579 predicted 5252
9 SASI_Mm02_00325118 predicted 3374
10 SASI_Mm01_00040580 predicted 4698
11 SASI_Mm01_00040577 predicted 4821
12 SASI_Mm01_00040581 predicted 4712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019825
NCOA6 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019825.1-1476s1c1
Sequence:CCGGCCTATGGTTCAACAGGGAAATCTCGAGATTTCCCTGTTGAACCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019825.1-6507s1c1
Sequence:CCGGCCTAGAGTACAGGGTGAACATCTCGAGATGTTCACCCTGTACTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019825.1-6445s1c1
Sequence:CCGGGCCATGTATTGAAAGGCGCTACTCGAGTAGCGCCTTTCAATACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019825.1-3128s1c1
Sequence:CCGGGCAACAACAAATGATGATGATCTCGAGATCATCATCATTTGTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019825.1-3847s1c1
Sequence:CCGGGCTTTGATCAACAGGGCTTAACTCGAGTTAAGCCCTGTTGATCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019825
NCOA6 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019825.1-1476s1c1
Sequence:CCGGCCTATGGTTCAACAGGGAAATCTCGAGATTTCCCTGTTGAACCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019825.1-6507s1c1
Sequence:CCGGCCTAGAGTACAGGGTGAACATCTCGAGATGTTCACCCTGTACTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019825.1-6445s1c1
Sequence:CCGGGCCATGTATTGAAAGGCGCTACTCGAGTAGCGCCTTTCAATACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019825.1-3128s1c1
Sequence:CCGGGCAACAACAAATGATGATGATCTCGAGATCATCATCATTTGTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019825.1-3847s1c1
Sequence:CCGGGCTTTGATCAACAGGGCTTAACTCGAGTTAAGCCCTGTTGATCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019825
NCOA6 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019825.1-1476s1c1
Sequence:CCGGCCTATGGTTCAACAGGGAAATCTCGAGATTTCCCTGTTGAACCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019825.1-6507s1c1
Sequence:CCGGCCTAGAGTACAGGGTGAACATCTCGAGATGTTCACCCTGTACTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019825.1-6445s1c1
Sequence:CCGGGCCATGTATTGAAAGGCGCTACTCGAGTAGCGCCTTTCAATACATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019825.1-3128s1c1
Sequence:CCGGGCAACAACAAATGATGATGATCTCGAGATCATCATCATTTGTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019825.1-3847s1c1
Sequence:CCGGGCTTTGATCAACAGGGCTTAACTCGAGTTAAGCCCTGTTGATCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014071
VALIDATED
NCOA6 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014071.2-2464s1c1
Sequence:CCGGGCAGATTATGACCAATCAAATCTCGAGATTTGATTGGTCATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014071.2-4959s1c1
Sequence:CCGGCCCTAAACTTACCTCACAGTACTCGAGTACTGTGAGGTAAGTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014071.2-6219s1c1
Sequence:CCGGCGTCGCAGAATTTAGTCTCAACTCGAGTTGAGACTAAATTCTGCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014071.2-3409s1c1
Sequence:CCGGGCAGCAACAAATGATGATGATCTCGAGATCATCATCATTTGTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014071.2-879s1c1
Sequence:CCGGCGGGTGGAAATGTGTCATCTTCTCGAGAAGATGACACATTTCCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014071.2-1072s21c1
Sequence:CCGGACAAATGAACCCAGCTAATTTCTCGAGAAATTAGCTGGGTTCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014071.2-2973s21c1
Sequence:CCGGGCCCATTGTTGGTCAACTTATCTCGAGATAAGTTGACCAACAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014071.2-4130s21c1
Sequence:CCGGTTTGATCAACAAGGCCTAAATCTCGAGATTTAGGCCTTGTTGATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014071.2-2464s21c1
Sequence:CCGGGCAGATTATGACCAATCAAATCTCGAGATTTGATTGGTCATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014071.2-6750s21c1
Sequence:CCGGGGAGCTAATGCCATTATAAATCTCGAGATTTATAATGGCATTAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014071
VALIDATED
NCOA6 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014071.2-2464s1c1
Sequence:CCGGGCAGATTATGACCAATCAAATCTCGAGATTTGATTGGTCATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014071.2-4959s1c1
Sequence:CCGGCCCTAAACTTACCTCACAGTACTCGAGTACTGTGAGGTAAGTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014071.2-6219s1c1
Sequence:CCGGCGTCGCAGAATTTAGTCTCAACTCGAGTTGAGACTAAATTCTGCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014071.2-3409s1c1
Sequence:CCGGGCAGCAACAAATGATGATGATCTCGAGATCATCATCATTTGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014071.2-879s1c1
Sequence:CCGGCGGGTGGAAATGTGTCATCTTCTCGAGAAGATGACACATTTCCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014071.2-1072s21c1
Sequence:CCGGACAAATGAACCCAGCTAATTTCTCGAGAAATTAGCTGGGTTCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014071.2-2973s21c1
Sequence:CCGGGCCCATTGTTGGTCAACTTATCTCGAGATAAGTTGACCAACAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014071.2-4130s21c1
Sequence:CCGGTTTGATCAACAAGGCCTAAATCTCGAGATTTAGGCCTTGTTGATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014071.2-2464s21c1
Sequence:CCGGGCAGATTATGACCAATCAAATCTCGAGATTTGATTGGTCATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014071.2-6750s21c1
Sequence:CCGGGGAGCTAATGCCATTATAAATCTCGAGATTTATAATGGCATTAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014071
VALIDATED
NCOA6 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014071.2-2464s1c1
Sequence:CCGGGCAGATTATGACCAATCAAATCTCGAGATTTGATTGGTCATAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014071.2-4959s1c1
Sequence:CCGGCCCTAAACTTACCTCACAGTACTCGAGTACTGTGAGGTAAGTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014071.2-6219s1c1
Sequence:CCGGCGTCGCAGAATTTAGTCTCAACTCGAGTTGAGACTAAATTCTGCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014071.2-3409s1c1
Sequence:CCGGGCAGCAACAAATGATGATGATCTCGAGATCATCATCATTTGTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014071.2-879s1c1
Sequence:CCGGCGGGTGGAAATGTGTCATCTTCTCGAGAAGATGACACATTTCCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014071.2-1072s21c1
Sequence:CCGGACAAATGAACCCAGCTAATTTCTCGAGAAATTAGCTGGGTTCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014071.2-2973s21c1
Sequence:CCGGGCCCATTGTTGGTCAACTTATCTCGAGATAAGTTGACCAACAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014071.2-4130s21c1
Sequence:CCGGTTTGATCAACAAGGCCTAAATCTCGAGATTTAGGCCTTGTTGATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014071.2-2464s21c1
Sequence:CCGGGCAGATTATGACCAATCAAATCTCGAGATTTGATTGGTCATAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014071.2-6750s21c1
Sequence:CCGGGGAGCTAATGCCATTATAAATCTCGAGATTTATAATGGCATTAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)