EMAIL THIS PAGE TO A FRIEND

NCOA7

nuclear receptor coactivator 7

193 Gene Product Result for
Synonyms: ERAP140 ESNA1 Nbla00052 Nbla10993 TLDC4 dJ187J11.3
Gene ID:
Mouse(211329) nuclear receptor coactivator 7
Rat(498995) nuclear receptor coactivator 7
chicken(421717) nuclear receptor coactivator 7
dog(476283) nuclear receptor coactivator 7
cow(541071) nuclear receptor coactivator 7
Horse(100067331) nuclear receptor coactivator 7
domestic cat(101083937) nuclear receptor coactivator 7
domestic guinea pig(100719284) nuclear receptor coactivator 7
naked mole-rat(101716476) nuclear receptor coactivator 7
sheep(101117768) nuclear receptor coactivator 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181782 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122842 Rosetta Predictions human pricing
NM_181782 Rosetta Predictions human pricing
XM_001058653 Rosetta Predictions rat pricing
XM_574285 Rosetta Predictions rat pricing
NM_001111267 Rosetta Predictions mouse pricing
NM_172495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327487 predicted 2053
2 SASI_Hs02_00327488 predicted 2208
3 SASI_Hs02_00327489 predicted 1969
4 SASI_Hs02_00327490 predicted 1679
5 SASI_Hs02_00327491 predicted 1949
6 SASI_Hs02_00327492 predicted 2795
7 SASI_Hs02_00327493 predicted 2730
8 SASI_Hs02_00327494 predicted 1410
9 SASI_Hs02_00327495 predicted 3111
10 SASI_Hs02_00327496 predicted 2663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370382 predicted 2088
2 SASI_Hs01_00107180 predicted 2234
3 SASI_Hs01_00107181 predicted 2004
4 SASI_Hs01_00107183 predicted 1711
5 SASI_Hs01_00107184 predicted 1980
6 SASI_Hs01_00107185 predicted 2826
7 SASI_Hs01_00107186 predicted 2767
8 SASI_Hs01_00107188 predicted 1440
9 SASI_Hs01_00107189 predicted 3138
10 SASI_Hs02_00370383 predicted 2696
11 SASI_Hs01_00107182 predicted 1765
12 SASI_Hs01_00107187 predicted 2891
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290405 predicted 1254
2 SASI_Rn02_00290406 predicted 355
3 SASI_Rn02_00290407 predicted 2488
4 SASI_Rn02_00290408 predicted 936
5 SASI_Rn02_00290409 predicted 464
6 SASI_Rn02_00290410 predicted 690
7 SASI_Rn02_00290411 predicted 2287
8 SASI_Rn02_00290412 predicted 2614
9 SASI_Rn02_00290413 predicted 1205
10 SASI_Rn02_00290414 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401700 predicted 1494
2 SASI_Rn02_00401701 predicted 587
3 SASI_Rn02_00401702 predicted 2719
4 SASI_Rn02_00401703 predicted 1167
5 SASI_Rn02_00401704 predicted 698
6 SASI_Rn02_00401705 predicted 217
7 SASI_Rn02_00401706 predicted 376
8 SASI_Rn02_00401707 predicted 921
9 SASI_Rn02_00401708 predicted 2519
10 SASI_Rn02_00401709 predicted 2851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306562 predicted 583
2 SASI_Mm02_00306563 predicted 803
3 SASI_Mm02_00306564 predicted 697
4 SASI_Mm02_00306565 predicted 722
5 SASI_Mm02_00306566 predicted 525
6 SASI_Mm02_00306567 predicted 789
7 SASI_Mm02_00306568 predicted 523
8 SASI_Mm02_00306569 predicted 572
9 SASI_Mm02_00306570 predicted 541
10 SASI_Mm02_00306571 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127107 predicted 2928
2 SASI_Mm02_00344072 predicted 3149
3 SASI_Mm02_00344073 predicted 3054
4 SASI_Mm02_00344074 predicted 3079
5 SASI_Mm01_00127109 predicted 2880
6 SASI_Mm02_00344075 predicted 3139
7 SASI_Mm02_00344076 predicted 2870
8 SASI_Mm02_00344077 predicted 2921
9 SASI_Mm01_00127113 predicted 2889
10 SASI_Mm02_00344078 predicted 2774
11 SASI_Mm01_00127108 predicted 1287
12 SASI_Mm01_00127110 predicted 907
13 SASI_Mm01_00127111 predicted 2073
14 SASI_Mm01_00127112 predicted 2992
15 SASI_Mm01_00127114 predicted 1942
16 SASI_Mm01_00127115 predicted 1249
17 SASI_Mm01_00127116 predicted 893
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181782
VALIDATED
NCOA7 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181782.3-2365s21c1
Sequence:CCGGTCGGGAGAGGGTGGATCATTTCTCGAGAAATGATCCACCCTCTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181782.3-3550s21c1
Sequence:CCGGCAGCACTTAAAGGGAATATATCTCGAGATATATTCCCTTTAAGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181782.3-1110s21c1
Sequence:CCGGTTGCGCTCTACAATGACATTTCTCGAGAAATGTCATTGTAGAGCGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181782.3-1985s21c1
Sequence:CCGGCCCATAACTGAGGGCAATAAACTCGAGTTTATTGCCCTCAGTTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181782.3-2830s21c1
Sequence:CCGGCAAGTTCAGTGACCACTATTACTCGAGTAATAGTGGTCACTGAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181782.3-2318s21c1
Sequence:CCGGCAGTACGGCAAACGGAGAAAGCTCGAGCTTTCTCCGTTTGCCGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181782.2-592s1c1
Sequence:CCGGGCGTACAGAACTAAAGAGATACTCGAGTATCTCTTTAGTTCTGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181782.2-2326s1c1
Sequence:CCGGCCTGTGCATCAAAGTGGGAAACTCGAGTTTCCCACTTTGATGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181782.2-2840s1c1
Sequence:CCGGCCTGTCCTATTGGTCATCAAACTCGAGTTTGATGACCAATAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181782.2-1809s1c1
Sequence:CCGGCCTGTGAGAAGCAAGATATAACTCGAGTTATATCTTGCTTCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181782.2-1413s1c1
Sequence:CCGGCCACAGGACATACACCTACAACTCGAGTTGTAGGTGTATGTCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181782
VALIDATED
NCOA7 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181782.3-2365s21c1
Sequence:CCGGTCGGGAGAGGGTGGATCATTTCTCGAGAAATGATCCACCCTCTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181782.3-3550s21c1
Sequence:CCGGCAGCACTTAAAGGGAATATATCTCGAGATATATTCCCTTTAAGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181782.3-1110s21c1
Sequence:CCGGTTGCGCTCTACAATGACATTTCTCGAGAAATGTCATTGTAGAGCGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181782.3-1985s21c1
Sequence:CCGGCCCATAACTGAGGGCAATAAACTCGAGTTTATTGCCCTCAGTTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181782.3-2830s21c1
Sequence:CCGGCAAGTTCAGTGACCACTATTACTCGAGTAATAGTGGTCACTGAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181782.3-2318s21c1
Sequence:CCGGCAGTACGGCAAACGGAGAAAGCTCGAGCTTTCTCCGTTTGCCGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181782.2-592s1c1
Sequence:CCGGGCGTACAGAACTAAAGAGATACTCGAGTATCTCTTTAGTTCTGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181782.2-2326s1c1
Sequence:CCGGCCTGTGCATCAAAGTGGGAAACTCGAGTTTCCCACTTTGATGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181782.2-2840s1c1
Sequence:CCGGCCTGTCCTATTGGTCATCAAACTCGAGTTTGATGACCAATAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181782.2-1809s1c1
Sequence:CCGGCCTGTGAGAAGCAAGATATAACTCGAGTTATATCTTGCTTCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181782.2-1413s1c1
Sequence:CCGGCCACAGGACATACACCTACAACTCGAGTTGTAGGTGTATGTCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181782
VALIDATED
NCOA7 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181782.3-2365s21c1
Sequence:CCGGTCGGGAGAGGGTGGATCATTTCTCGAGAAATGATCCACCCTCTCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181782.3-3550s21c1
Sequence:CCGGCAGCACTTAAAGGGAATATATCTCGAGATATATTCCCTTTAAGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181782.3-1110s21c1
Sequence:CCGGTTGCGCTCTACAATGACATTTCTCGAGAAATGTCATTGTAGAGCGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181782.3-1985s21c1
Sequence:CCGGCCCATAACTGAGGGCAATAAACTCGAGTTTATTGCCCTCAGTTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181782.3-2830s21c1
Sequence:CCGGCAAGTTCAGTGACCACTATTACTCGAGTAATAGTGGTCACTGAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181782.3-2318s21c1
Sequence:CCGGCAGTACGGCAAACGGAGAAAGCTCGAGCTTTCTCCGTTTGCCGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181782.2-592s1c1
Sequence:CCGGGCGTACAGAACTAAAGAGATACTCGAGTATCTCTTTAGTTCTGTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181782.2-2326s1c1
Sequence:CCGGCCTGTGCATCAAAGTGGGAAACTCGAGTTTCCCACTTTGATGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181782.2-2840s1c1
Sequence:CCGGCCTGTCCTATTGGTCATCAAACTCGAGTTTGATGACCAATAGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181782.2-1809s1c1
Sequence:CCGGCCTGTGAGAAGCAAGATATAACTCGAGTTATATCTTGCTTCTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181782.2-1413s1c1
Sequence:CCGGCCACAGGACATACACCTACAACTCGAGTTGTAGGTGTATGTCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172495
NCOA7 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor coactivator 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-2897s21c1
Sequence:CCGGCAAGTTCAGTGACCACTATTACTCGAGTAATAGTGGTCACTGAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-2853s21c1
Sequence:CCGGGACATGGATAACCAGATATTTCTCGAGAAATATCTGGTTATCCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172495.5-4534s21c1
Sequence:CCGGAGTAGTCTATCGCGAATTATTCTCGAGAATAATTCGCGATAGACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172495.5-4678s1c1
Sequence:CCGGCATCAGGCCGATCACTATATTCTCGAGAATATAGTGATCGGCCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.5-2939s1c1
Sequence:CCGGCTACACCTTTAGTCCGAATTTCTCGAGAAATTCGGACTAAAGGTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-2530s21c1
Sequence:CCGGAGCTGAACATGATCGACAATTCTCGAGAATTGTCGATCATGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-953s21c1
Sequence:CCGGACCCATCGAGAGGGTCTTATCCTCGAGGATAAGACCCTCTCGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.2-934s1c1
Sequence:CCGGCCGATCCCTTAGTGATTGAAACTCGAGTTTCAATCACTAAGGGATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.2-2865s1c1
Sequence:CCGGCGATTTGGTCTGTGGCTAGATCTCGAGATCTAGCCACAGACCAAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.2-1271s1c1
Sequence:CCGGCAACTCTGAATTGTGGAAATTCTCGAGAATTTCCACAATTCAGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172495
NCOA7 MISSION shRNA shRNA Plasmid DNA
nuclear receptor coactivator 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-2897s21c1
Sequence:CCGGCAAGTTCAGTGACCACTATTACTCGAGTAATAGTGGTCACTGAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-2853s21c1
Sequence:CCGGGACATGGATAACCAGATATTTCTCGAGAAATATCTGGTTATCCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172495.5-4534s21c1
Sequence:CCGGAGTAGTCTATCGCGAATTATTCTCGAGAATAATTCGCGATAGACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172495.5-4678s1c1
Sequence:CCGGCATCAGGCCGATCACTATATTCTCGAGAATATAGTGATCGGCCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.5-2939s1c1
Sequence:CCGGCTACACCTTTAGTCCGAATTTCTCGAGAAATTCGGACTAAAGGTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-2530s21c1
Sequence:CCGGAGCTGAACATGATCGACAATTCTCGAGAATTGTCGATCATGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-953s21c1
Sequence:CCGGACCCATCGAGAGGGTCTTATCCTCGAGGATAAGACCCTCTCGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.2-934s1c1
Sequence:CCGGCCGATCCCTTAGTGATTGAAACTCGAGTTTCAATCACTAAGGGATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.2-2865s1c1
Sequence:CCGGCGATTTGGTCTGTGGCTAGATCTCGAGATCTAGCCACAGACCAAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.2-1271s1c1
Sequence:CCGGCAACTCTGAATTGTGGAAATTCTCGAGAATTTCCACAATTCAGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172495
NCOA7 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor coactivator 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-2897s21c1
Sequence:CCGGCAAGTTCAGTGACCACTATTACTCGAGTAATAGTGGTCACTGAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-2853s21c1
Sequence:CCGGGACATGGATAACCAGATATTTCTCGAGAAATATCTGGTTATCCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172495.5-4534s21c1
Sequence:CCGGAGTAGTCTATCGCGAATTATTCTCGAGAATAATTCGCGATAGACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172495.5-4678s1c1
Sequence:CCGGCATCAGGCCGATCACTATATTCTCGAGAATATAGTGATCGGCCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.5-2939s1c1
Sequence:CCGGCTACACCTTTAGTCCGAATTTCTCGAGAAATTCGGACTAAAGGTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-2530s21c1
Sequence:CCGGAGCTGAACATGATCGACAATTCTCGAGAATTGTCGATCATGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172495.5-953s21c1
Sequence:CCGGACCCATCGAGAGGGTCTTATCCTCGAGGATAAGACCCTCTCGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.2-934s1c1
Sequence:CCGGCCGATCCCTTAGTGATTGAAACTCGAGTTTCAATCACTAAGGGATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.2-2865s1c1
Sequence:CCGGCGATTTGGTCTGTGGCTAGATCTCGAGATCTAGCCACAGACCAAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172495.2-1271s1c1
Sequence:CCGGCAACTCTGAATTGTGGAAATTCTCGAGAATTTCCACAATTCAGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)