EMAIL THIS PAGE TO A FRIEND

NCOR2

nuclear receptor corepressor 2

131 Gene Product Result for
Synonyms: CTG26 N-CoR2 SMAP270 SMRT SMRTE SMRTE-tau TNRC14 TRAC TRAC-1 TRAC1
Gene ID:
Human(9612) Summary: This gene encodes a nuclear receptor co-repressor that mediates transcriptional silencing of certain target genes. The encoded protein is a member of a family of thyroid hormone- and retinoic acid receptor-associated co-repressors. This protein acts as part of a multisubunit complex which includes histone deacetylases to modify chromatin structure that prevents basal transcriptional activity of target genes. Aberrant expression of this gene is associated with certain cancers. Alternate splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Apr 2011]
Mouse(20602) nuclear receptor co-repressor 2
Rat(360801) nuclear receptor co-repressor 2
Zebrafish(561503) nuclear receptor co-repressor 2
chicken(416815) nuclear receptor corepressor 2
cow(538549) nuclear receptor corepressor 2
Horse(100059253) nuclear receptor corepressor 2
domestic cat(101083973) nuclear receptor corepressor 2
dog(486242) nuclear receptor corepressor 2
domestic guinea pig(100720194) nuclear receptor corepressor 2
naked mole-rat(101702626) nuclear receptor corepressor 2
sheep(101121042) nuclear receptor corepressor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32463 Anti-NCOR2 (AB1) antibody produced in rabbit affinity isolated antibody pig, rat, mouse, human
western blot pricing
AV32464 Anti-NCOR2 (AB2) antibody produced in rabbit IgG fraction of antiserum pig, rat, human, mouse
western blot pricing
HPA001928 Anti-NCOR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4503680 Anti-NCOR2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB2702161 Monoclonal Anti-NCOR2 antibody produced in mouse human, monkey
ChIP, immunofluorescence, immunoprecipitation (IP) pricing
SAB2702163 Monoclonal Anti-NCOR2 antibody produced in mouse human
immunoprecipitation (IP), western blot pricing
PLA0171 Rabbit anti-SMRT Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. ferret, rabbit, rhesus monkey, chimpanzee, pig, primate, bovine, dog, marmoset, human, horse
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006312 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159481 MISSION® esiRNA esiRNA human NCOR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077261 Rosetta Predictions human pricing
NM_006312 Rosetta Predictions human pricing
NM_001108334 Rosetta Predictions rat pricing
NM_011424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312314 predicted 1012
2 SASI_Hs02_00312315 predicted 1040
3 SASI_Hs02_00312316 predicted 3934
4 SASI_Hs02_00312317 predicted 2023
5 SASI_Hs02_00312318 predicted 6838
6 SASI_Hs02_00312319 predicted 6117
7 SASI_Hs02_00312320 predicted 4250
8 SASI_Hs02_00312321 predicted 3930
9 SASI_Hs02_00312322 predicted 987
10 SASI_Hs02_00312323 predicted 3956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341333 predicted 1015
2 SASI_Hs02_00341334 predicted 1041
3 SASI_Hs01_00014776 predicted 3985
4 SASI_Hs01_00014778 predicted 2016
5 SASI_Hs01_00014779 predicted 6887
6 SASI_Hs01_00014780 predicted 6163
7 SASI_Hs01_00014781 predicted 4298
8 SASI_Hs01_00014783 predicted 3972
9 SASI_Hs02_00341335 predicted 987
10 SASI_Hs02_00341336 predicted 4010
11 SASI_Hs01_00014775 predicted 2221
12 SASI_Hs01_00014777 predicted 1135
13 SASI_Hs01_00014782 predicted 2441
14 SASI_Hs01_00014784 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237639 predicted 4405
2 SASI_Rn02_00237640 predicted 2737
3 SASI_Rn02_00237641 predicted 1333
4 SASI_Rn02_00237642 predicted 6080
5 SASI_Rn02_00237643 predicted 2377
6 SASI_Rn02_00237644 predicted 6876
7 SASI_Rn02_00237645 predicted 3909
8 SASI_Rn02_00237646 predicted 2954
9 SASI_Rn02_00237647 predicted 300
10 SASI_Rn02_00237648 predicted 6880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187422 predicted 4709
2 SASI_Mm01_00187423 predicted 6382
3 SASI_Mm01_00187424 predicted 4223
4 SASI_Mm01_00187425 predicted 2577
5 SASI_Mm01_00187426 predicted 446
6 SASI_Mm01_00187427 predicted 2802
7 SASI_Mm02_00320644 predicted 7198
8 SASI_Mm01_00187428 predicted 3464
9 SASI_Mm01_00187430 predicted 5692
10 SASI_Mm01_00187431 predicted 503
11 SASI_Mm01_00187429 predicted 3286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006312
VALIDATED
NCOR2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor corepressor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006312.3-7979s21c1
Sequence:CCGGGCCTGTCTAAAGCCTTAACTACTCGAGTAGTTAAGGCTTTAGACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-5808s21c1
Sequence:CCGGGCTTCACAACACAGGCATGAACTCGAGTTCATGCCTGTGTTGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-7217s21c1
Sequence:CCGGGAAAGGCACTCATGGGTAAATCTCGAGATTTACCCATGAGTGCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-2097s21c1
Sequence:CCGGGCAGTGTAAGAACTTCTACTTCTCGAGAAGTAGAAGTTCTTACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-1368s21c1
Sequence:CCGGGCAGCGCATCAAGTTCATCAACTCGAGTTGATGAACTTGATGCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-1942s1c1
Sequence:CCGGGCAGTGTAAGAACTTCTACTTCTCGAGAAGTAGAAGTTCTTACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-1402s1c1
Sequence:CCGGCCTCTATTACTACCTGACTAACTCGAGTTAGTCAGGTAGTAATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-7715s1c1
Sequence:CCGGGCCTGTCTAAAGCCTTAACTACTCGAGTAGTTAAGGCTTTAGACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-5632s1c1
Sequence:CCGGGCTTCACAACACAGGCATGAACTCGAGTTCATGCCTGTGTTGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-1213s1c1
Sequence:CCGGGCAGCGCATCAAGTTCATCAACTCGAGTTGATGAACTTGATGCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006312
VALIDATED
NCOR2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor corepressor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006312.3-7979s21c1
Sequence:CCGGGCCTGTCTAAAGCCTTAACTACTCGAGTAGTTAAGGCTTTAGACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-5808s21c1
Sequence:CCGGGCTTCACAACACAGGCATGAACTCGAGTTCATGCCTGTGTTGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-7217s21c1
Sequence:CCGGGAAAGGCACTCATGGGTAAATCTCGAGATTTACCCATGAGTGCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-2097s21c1
Sequence:CCGGGCAGTGTAAGAACTTCTACTTCTCGAGAAGTAGAAGTTCTTACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-1368s21c1
Sequence:CCGGGCAGCGCATCAAGTTCATCAACTCGAGTTGATGAACTTGATGCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-1942s1c1
Sequence:CCGGGCAGTGTAAGAACTTCTACTTCTCGAGAAGTAGAAGTTCTTACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-1402s1c1
Sequence:CCGGCCTCTATTACTACCTGACTAACTCGAGTTAGTCAGGTAGTAATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-7715s1c1
Sequence:CCGGGCCTGTCTAAAGCCTTAACTACTCGAGTAGTTAAGGCTTTAGACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-5632s1c1
Sequence:CCGGGCTTCACAACACAGGCATGAACTCGAGTTCATGCCTGTGTTGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-1213s1c1
Sequence:CCGGGCAGCGCATCAAGTTCATCAACTCGAGTTGATGAACTTGATGCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006312
VALIDATED
NCOR2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor corepressor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006312.3-7979s21c1
Sequence:CCGGGCCTGTCTAAAGCCTTAACTACTCGAGTAGTTAAGGCTTTAGACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-5808s21c1
Sequence:CCGGGCTTCACAACACAGGCATGAACTCGAGTTCATGCCTGTGTTGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-7217s21c1
Sequence:CCGGGAAAGGCACTCATGGGTAAATCTCGAGATTTACCCATGAGTGCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-2097s21c1
Sequence:CCGGGCAGTGTAAGAACTTCTACTTCTCGAGAAGTAGAAGTTCTTACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006312.3-1368s21c1
Sequence:CCGGGCAGCGCATCAAGTTCATCAACTCGAGTTGATGAACTTGATGCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-1942s1c1
Sequence:CCGGGCAGTGTAAGAACTTCTACTTCTCGAGAAGTAGAAGTTCTTACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-1402s1c1
Sequence:CCGGCCTCTATTACTACCTGACTAACTCGAGTTAGTCAGGTAGTAATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-7715s1c1
Sequence:CCGGGCCTGTCTAAAGCCTTAACTACTCGAGTAGTTAAGGCTTTAGACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-5632s1c1
Sequence:CCGGGCTTCACAACACAGGCATGAACTCGAGTTCATGCCTGTGTTGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006312.1-1213s1c1
Sequence:CCGGGCAGCGCATCAAGTTCATCAACTCGAGTTGATGAACTTGATGCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011424
VALIDATED
NCOR2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor corepressor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011424.2-7377s21c1
Sequence:CCGGGAAAGGCACTCATGGGTAAATCTCGAGATTTACCCATGAGTGCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011424.2-8577s21c1
Sequence:CCGGTGTTGGCTTACAGGGTATATTCTCGAGAATATACCCTGTAAGCCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011424.2-5540s21c1
Sequence:CCGGTCCTCGCTGGCCCTCAATTATCTCGAGATAATTGAGGGCCAGCGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011424.2-6751s21c1
Sequence:CCGGGCACATCAGTGAGGTCATTACCTCGAGGTAATGACCTCACTGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011424.2-7236s21c1
Sequence:CCGGACGAGCCAGAATACAATATTGCTCGAGCAATATTGTATTCTGGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-843s1c1
Sequence:CCGGCCAGATCATCTACGATGAGAACTCGAGTTCTCATCGTAGATGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011424.1-1501s1c1
Sequence:CCGGCCTAAGAACTTTGGCCTGATTCTCGAGAATCAGGCCAAAGTTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-2088s1c1
Sequence:CCGGCCAGTGTAAGAACTTCTACTTCTCGAGAAGTAGAAGTTCTTACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-1500s1c1
Sequence:CCGGCCCTAAGAACTTTGGCCTGATCTCGAGATCAGGCCAAAGTTCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-7714s1c1
Sequence:CCGGCCTGTCTAAAGCCTTAACTAACTCGAGTTAGTTAAGGCTTTAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011424
VALIDATED
NCOR2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor corepressor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011424.2-7377s21c1
Sequence:CCGGGAAAGGCACTCATGGGTAAATCTCGAGATTTACCCATGAGTGCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011424.2-8577s21c1
Sequence:CCGGTGTTGGCTTACAGGGTATATTCTCGAGAATATACCCTGTAAGCCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011424.2-5540s21c1
Sequence:CCGGTCCTCGCTGGCCCTCAATTATCTCGAGATAATTGAGGGCCAGCGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011424.2-6751s21c1
Sequence:CCGGGCACATCAGTGAGGTCATTACCTCGAGGTAATGACCTCACTGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011424.2-7236s21c1
Sequence:CCGGACGAGCCAGAATACAATATTGCTCGAGCAATATTGTATTCTGGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-843s1c1
Sequence:CCGGCCAGATCATCTACGATGAGAACTCGAGTTCTCATCGTAGATGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011424.1-1501s1c1
Sequence:CCGGCCTAAGAACTTTGGCCTGATTCTCGAGAATCAGGCCAAAGTTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-2088s1c1
Sequence:CCGGCCAGTGTAAGAACTTCTACTTCTCGAGAAGTAGAAGTTCTTACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-1500s1c1
Sequence:CCGGCCCTAAGAACTTTGGCCTGATCTCGAGATCAGGCCAAAGTTCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-7714s1c1
Sequence:CCGGCCTGTCTAAAGCCTTAACTAACTCGAGTTAGTTAAGGCTTTAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011424
VALIDATED
NCOR2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor corepressor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011424.2-7377s21c1
Sequence:CCGGGAAAGGCACTCATGGGTAAATCTCGAGATTTACCCATGAGTGCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011424.2-8577s21c1
Sequence:CCGGTGTTGGCTTACAGGGTATATTCTCGAGAATATACCCTGTAAGCCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011424.2-5540s21c1
Sequence:CCGGTCCTCGCTGGCCCTCAATTATCTCGAGATAATTGAGGGCCAGCGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011424.2-6751s21c1
Sequence:CCGGGCACATCAGTGAGGTCATTACCTCGAGGTAATGACCTCACTGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011424.2-7236s21c1
Sequence:CCGGACGAGCCAGAATACAATATTGCTCGAGCAATATTGTATTCTGGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-843s1c1
Sequence:CCGGCCAGATCATCTACGATGAGAACTCGAGTTCTCATCGTAGATGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011424.1-1501s1c1
Sequence:CCGGCCTAAGAACTTTGGCCTGATTCTCGAGAATCAGGCCAAAGTTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-2088s1c1
Sequence:CCGGCCAGTGTAAGAACTTCTACTTCTCGAGAAGTAGAAGTTCTTACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-1500s1c1
Sequence:CCGGCCCTAAGAACTTTGGCCTGATCTCGAGATCAGGCCAAAGTTCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011424.1-7714s1c1
Sequence:CCGGCCTGTCTAAAGCCTTAACTAACTCGAGTTAGTTAAGGCTTTAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)