EMAIL THIS PAGE TO A FRIEND

NCR2

natural cytotoxicity triggering receptor 2

29 Gene Product Result for
Synonyms: CD336 LY95 NK-p44 NKP44 dJ149M18.1
UniProtKB ID: O95944, Q9H562, Q9H563, Q9H564, Q9UMT1, Q9UMT2
Gene ID:
domestic guinea pig(101787826) natural cytotoxicity triggering receptor 2
Horse(100066291) natural cytotoxicity triggering receptor 2
dog(609023) natural cytotoxicity triggering receptor 2
domestic cat(101090864) natural cytotoxicity triggering receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1599 Human NKp44 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004828 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004828 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178645 predicted 395
2 SASI_Hs01_00178646 predicted 385
3 SASI_Hs01_00178647 predicted 366
4 SASI_Hs01_00178648 predicted 309
5 SASI_Hs01_00178649 predicted 437
6 SASI_Hs01_00178650 predicted 336
7 SASI_Hs01_00178652 predicted 394
8 SASI_Hs01_00178653 predicted 243
9 SASI_Hs01_00178654 predicted 246
10 SASI_Hs02_00338398 predicted 358
11 SASI_Hs01_00178651 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004828
NCR2 MISSION shRNA Bacterial Glycerol Stock
natural cytotoxicity triggering receptor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-156s1c1
Sequence:CCGGCCAAGGCTCAGGTACTTCAAACTCGAGTTTGAAGTACCTGAGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-315s1c1
Sequence:CCGGCTTGGACCTCTCGATTCACAACTCGAGTTGTGAATCGAGAGGTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-386s1c1
Sequence:CCGGAGAGAGGAAGACTCAGGACATCTCGAGATGTCCTGAGTCTTCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-442s1c1
Sequence:CCGGTGTCTCTAAGTCCGTCAGATTCTCGAGAATCTGACGGACTTAGAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-583s1c1
Sequence:CCGGCCCTGAGTCTCCATCTACCATCTCGAGATGGTAGATGGAGACTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-194s21c1
Sequence:CCGGTAACCGTGAGATGCCAGTACCCTCGAGGGTACTGGCATCTCACGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-764s21c1
Sequence:CCGGTCAGGAGCCTGGATACCCAAACTCGAGTTTGGGTATCCAGGCTCCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-412s21c1
Sequence:CCGGTGTAGAATCTACCGCCCTTCTCTCGAGAGAAGGGCGGTAGATTCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-222s21c1
Sequence:CCGGGGGCAGTCTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAGACTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004828
NCR2 MISSION shRNA shRNA Plasmid DNA
natural cytotoxicity triggering receptor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-156s1c1
Sequence:CCGGCCAAGGCTCAGGTACTTCAAACTCGAGTTTGAAGTACCTGAGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-315s1c1
Sequence:CCGGCTTGGACCTCTCGATTCACAACTCGAGTTGTGAATCGAGAGGTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-386s1c1
Sequence:CCGGAGAGAGGAAGACTCAGGACATCTCGAGATGTCCTGAGTCTTCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-442s1c1
Sequence:CCGGTGTCTCTAAGTCCGTCAGATTCTCGAGAATCTGACGGACTTAGAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-583s1c1
Sequence:CCGGCCCTGAGTCTCCATCTACCATCTCGAGATGGTAGATGGAGACTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-194s21c1
Sequence:CCGGTAACCGTGAGATGCCAGTACCCTCGAGGGTACTGGCATCTCACGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-764s21c1
Sequence:CCGGTCAGGAGCCTGGATACCCAAACTCGAGTTTGGGTATCCAGGCTCCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-412s21c1
Sequence:CCGGTGTAGAATCTACCGCCCTTCTCTCGAGAGAAGGGCGGTAGATTCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-222s21c1
Sequence:CCGGGGGCAGTCTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAGACTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004828
NCR2 MISSION shRNA Lentiviral Transduction Particles
natural cytotoxicity triggering receptor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-156s1c1
Sequence:CCGGCCAAGGCTCAGGTACTTCAAACTCGAGTTTGAAGTACCTGAGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-315s1c1
Sequence:CCGGCTTGGACCTCTCGATTCACAACTCGAGTTGTGAATCGAGAGGTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-386s1c1
Sequence:CCGGAGAGAGGAAGACTCAGGACATCTCGAGATGTCCTGAGTCTTCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-442s1c1
Sequence:CCGGTGTCTCTAAGTCCGTCAGATTCTCGAGAATCTGACGGACTTAGAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004828.2-583s1c1
Sequence:CCGGCCCTGAGTCTCCATCTACCATCTCGAGATGGTAGATGGAGACTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-194s21c1
Sequence:CCGGTAACCGTGAGATGCCAGTACCCTCGAGGGTACTGGCATCTCACGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-764s21c1
Sequence:CCGGTCAGGAGCCTGGATACCCAAACTCGAGTTTGGGTATCCAGGCTCCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-412s21c1
Sequence:CCGGTGTAGAATCTACCGCCCTTCTCTCGAGAGAAGGGCGGTAGATTCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004828.3-222s21c1
Sequence:CCGGGGGCAGTCTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAGACTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)