EMAIL THIS PAGE TO A FRIEND

NCR3LG1

natural killer cell cytotoxicity receptor 3 ligand 1

56 Gene Product Result for
Synonyms: B7-H6 B7H6 DKFZp686O24166
UniProtKB ID: Q68D85, Q7Z3M6
Gene ID:
Human(374383) Summary: B7H6 belongs to the B7 family (see MIM 605402) and is selectively expressed on tumor cells. Interaction of B7H6 with NKp30 (NCR3; MIM 611550) results in natural killer (NK) cell activation and cytotoxicity (Brandt et al., 2009 [PubMed 19528259]
Rat(691092) natural killer cell cytotoxicity receptor 3 ligand 1
sheep(101114384) natural killer cell cytotoxicity receptor 3 ligand 1
domestic guinea pig(101788216) natural killer cell cytotoxicity receptor 3 ligand 1
naked mole-rat(101704821) natural killer cell cytotoxicity receptor 3 ligand 1
domestic cat(101095854) natural killer cell cytotoxicity receptor 3 ligand 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305823 ANTI-B7H6(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009913 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009913 Rosetta Predictions human pricing
XM_001716694 Rosetta Predictions human pricing
XM_001717238 Rosetta Predictions human pricing
XM_001717546 Rosetta Predictions human pricing
XM_001076811 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157291 predicted 664
2 SASI_Hs01_00157292 predicted 642
3 SASI_Hs01_00157293 predicted 412
4 SASI_Hs01_00157294 predicted 833
5 SASI_Hs01_00157295 predicted 416
6 SASI_Hs01_00157296 predicted 656
7 SASI_Hs01_00157297 predicted 673
8 SASI_Hs01_00157298 predicted 471
9 SASI_Hs01_00157299 predicted 347
10 SASI_Hs01_00157300 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00412282 predicted 124
2 SASI_Hs02_00412283 predicted 966
3 SASI_Hs02_00412284 predicted 947
4 SASI_Hs02_00412285 predicted 958
5 SASI_Hs02_00412286 predicted 981
6 SASI_Hs02_00412287 predicted 1313
7 SASI_Hs02_00412288 predicted 391
8 SASI_Hs02_00412289 predicted 1321
9 SASI_Hs02_00412290 predicted 645
10 SASI_Hs02_00412291 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00415928 predicted 971
2 SASI_Hs02_00415929 predicted 949
3 SASI_Hs02_00415930 predicted 711
4 SASI_Hs02_00415931 predicted 1144
5 SASI_Hs02_00415932 predicted 715
6 SASI_Hs02_00415933 predicted 411
7 SASI_Hs02_00415934 predicted 961
8 SASI_Hs02_00415935 predicted 980
9 SASI_Hs02_00415936 predicted 768
10 SASI_Hs02_00415937 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00417886 predicted 811
2 SASI_Hs02_00417887 predicted 796
3 SASI_Hs02_00417888 predicted 560
4 SASI_Hs02_00417889 predicted 990
5 SASI_Hs02_00417890 predicted 561
6 SASI_Hs02_00417891 predicted 254
7 SASI_Hs02_00417892 predicted 802
8 SASI_Hs02_00417893 predicted 826
9 SASI_Hs02_00417894 predicted 621
10 SASI_Hs02_00417895 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354656 predicted 398
2 SASI_Rn02_00354657 predicted 394
3 SASI_Rn02_00354658 predicted 230
4 SASI_Rn02_00354659 predicted 396
5 SASI_Rn02_00354660 predicted 395
6 SASI_Rn02_00354661 predicted 327
7 SASI_Rn02_00354662 predicted 404
8 SASI_Rn02_00354663 predicted 389
9 SASI_Rn02_00354664 predicted 231
10 SASI_Rn02_00354665 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009913
NCR3LG1 MISSION shRNA Bacterial Glycerol Stock
natural killer cell cytotoxicity receptor 3 ligand 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-953s1c1
Sequence:CCGGCGGCACAGTCTTTCTGAAACTCTCGAGAGTTTCAGAAAGACTGTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-324s1c1
Sequence:CCGGCCCTGAATGACAATGTCACCACTCGAGTGGTGACATTGTCATTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-653s1c1
Sequence:CCGGCTGGATCAAGTGGGCATGAAACTCGAGTTTCATGCCCACTTGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-1223s1c1
Sequence:CCGGCCTGAGGGAAGTGTTAATATTCTCGAGAATATTAACACTTCCCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-1370s1c1
Sequence:CCGGGCTCTCCTAACAGTTACATCACTCGAGTGATGTAACTGTTAGGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-763s1c1
Sequence:CCGGCCATCCCATAGAGATTTCTGACTCGAGTCAGAAATCTCTATGGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009913.1-4770s1c1
Sequence:CCGGCGGGTAGATGAAATAGCCAAACTCGAGTTTGGCTATTTCATCTACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-1145s1c1
Sequence:CCGGCTGAAGAAAGAGCACCTCATACTCGAGTATGAGGTGCTCTTTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009913
NCR3LG1 MISSION shRNA shRNA Plasmid DNA
natural killer cell cytotoxicity receptor 3 ligand 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-953s1c1
Sequence:CCGGCGGCACAGTCTTTCTGAAACTCTCGAGAGTTTCAGAAAGACTGTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-324s1c1
Sequence:CCGGCCCTGAATGACAATGTCACCACTCGAGTGGTGACATTGTCATTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-653s1c1
Sequence:CCGGCTGGATCAAGTGGGCATGAAACTCGAGTTTCATGCCCACTTGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-1223s1c1
Sequence:CCGGCCTGAGGGAAGTGTTAATATTCTCGAGAATATTAACACTTCCCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-1370s1c1
Sequence:CCGGGCTCTCCTAACAGTTACATCACTCGAGTGATGTAACTGTTAGGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-763s1c1
Sequence:CCGGCCATCCCATAGAGATTTCTGACTCGAGTCAGAAATCTCTATGGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009913.1-4770s1c1
Sequence:CCGGCGGGTAGATGAAATAGCCAAACTCGAGTTTGGCTATTTCATCTACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-1145s1c1
Sequence:CCGGCTGAAGAAAGAGCACCTCATACTCGAGTATGAGGTGCTCTTTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009913
NCR3LG1 MISSION shRNA Lentiviral Transduction Particles
natural killer cell cytotoxicity receptor 3 ligand 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-953s1c1
Sequence:CCGGCGGCACAGTCTTTCTGAAACTCTCGAGAGTTTCAGAAAGACTGTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-324s1c1
Sequence:CCGGCCCTGAATGACAATGTCACCACTCGAGTGGTGACATTGTCATTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-653s1c1
Sequence:CCGGCTGGATCAAGTGGGCATGAAACTCGAGTTTCATGCCCACTTGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-1223s1c1
Sequence:CCGGCCTGAGGGAAGTGTTAATATTCTCGAGAATATTAACACTTCCCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-1370s1c1
Sequence:CCGGGCTCTCCTAACAGTTACATCACTCGAGTGATGTAACTGTTAGGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-763s1c1
Sequence:CCGGCCATCCCATAGAGATTTCTGACTCGAGTCAGAAATCTCTATGGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009913.1-4770s1c1
Sequence:CCGGCGGGTAGATGAAATAGCCAAACTCGAGTTTGGCTATTTCATCTACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009913.1-1145s1c1
Sequence:CCGGCTGAAGAAAGAGCACCTCATACTCGAGTATGAGGTGCTCTTTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)