EMAIL THIS PAGE TO A FRIEND

NCS1

neuronal calcium sensor 1

58 Gene Product Result for
Synonyms: FLUP FREQ
UniProtKB ID: P62166, E9PAY3, P36610, Q9UK26
Gene ID:
Human(23413) Summary: This gene is a member of the neuronal calcium sensor gene family, which encode calcium-binding proteins expressed predominantly in neurons. The protein encoded by this gene regulates G protein-coupled receptor phosphorylation in a calcium-dependent manner and can substitute for calmodulin. The protein is associated with secretory granules and modulates synaptic transmission and synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14299) neuronal calcium sensor 1
Rat(65153) neuronal calcium sensor 1
chicken(396336) neuronal calcium sensor 1
domestic cat(101097027) neuronal calcium sensor 1
cow(526544) neuronal calcium sensor 1
dog(491294) neuronal calcium sensor 1
sheep(101102136) neuronal calcium sensor 1
naked mole-rat(101697732) neuronal calcium sensor 1
domestic guinea pig(100732388) neuronal calcium sensor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014286 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049011 MISSION® esiRNA esiRNA human FREQ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014286 Rosetta Predictions human pricing
NM_024366 Rosetta Predictions rat pricing
NM_019681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075224 predicted 447
2 SASI_Hs01_00075225 predicted 314
3 SASI_Hs01_00075227 predicted 318
4 SASI_Hs01_00075228 predicted 628
5 SASI_Hs01_00075229 predicted 536
6 SASI_Hs01_00075230 predicted 320
7 SASI_Hs02_00345370 predicted 676
8 SASI_Hs01_00075232 predicted 612
9 SASI_Hs01_00075233 predicted 631
10 SASI_Hs02_00345371 predicted 395
11 SASI_Hs01_00075226 predicted 453
12 SASI_Hs01_00075231 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090444 predicted 236
2 SASI_Rn01_00090445 predicted 287
3 SASI_Rn01_00090447 predicted 533
4 SASI_Rn01_00090448 predicted 303
5 SASI_Rn01_00090449 predicted 608
6 SASI_Rn01_00090452 predicted 404
7 SASI_Rn02_00263951 predicted 372
8 SASI_Rn02_00263952 predicted 399
9 SASI_Rn02_00263953 predicted 530
10 SASI_Rn02_00263954 predicted 468
11 SASI_Rn01_00090443 predicted 372
12 SASI_Rn01_00090446 predicted 430
13 SASI_Rn01_00090450 predicted 515
14 SASI_Rn01_00090451 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049272 predicted 437
2 SASI_Mm01_00049273 predicted 621
3 SASI_Mm01_00049274 predicted 599
4 SASI_Mm01_00049275 predicted 603
5 SASI_Mm01_00049277 predicted 502
6 SASI_Mm01_00049278 predicted 412
7 SASI_Mm01_00049279 predicted 482
8 SASI_Mm01_00049280 predicted 850
9 SASI_Mm01_00049281 predicted 616
10 SASI_Mm02_00324758 predicted 563
11 SASI_Mm01_00049276 predicted 841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019681
VALIDATED
NCS1 MISSION shRNA Bacterial Glycerol Stock
neuronal calcium sensor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-3291s1c1
Sequence:CCGGCCCATCTGATTCTGCTTTCTTCTCGAGAAGAAAGCAGAATCAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-493s1c1
Sequence:CCGGGATTGAGTTCTCCGAGTTCATCTCGAGATGAACTCGGAGAACTCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-712s1c1
Sequence:CCGGCTTTGCCATGATGGACAAGAACTCGAGTTCTTGTCCATCATGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-490s1c1
Sequence:CCGGCAGGATTGAGTTCTCCGAGTTCTCGAGAACTCGGAGAACTCAATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-437s1c1
Sequence:CCGGCCCACCAAGTTCGCCACGTTTCTCGAGAAACGTGGCGAACTTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019681
VALIDATED
NCS1 MISSION shRNA shRNA Plasmid DNA
neuronal calcium sensor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-3291s1c1
Sequence:CCGGCCCATCTGATTCTGCTTTCTTCTCGAGAAGAAAGCAGAATCAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-493s1c1
Sequence:CCGGGATTGAGTTCTCCGAGTTCATCTCGAGATGAACTCGGAGAACTCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-712s1c1
Sequence:CCGGCTTTGCCATGATGGACAAGAACTCGAGTTCTTGTCCATCATGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-490s1c1
Sequence:CCGGCAGGATTGAGTTCTCCGAGTTCTCGAGAACTCGGAGAACTCAATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-437s1c1
Sequence:CCGGCCCACCAAGTTCGCCACGTTTCTCGAGAAACGTGGCGAACTTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019681
VALIDATED
NCS1 MISSION shRNA Lentiviral Transduction Particles
neuronal calcium sensor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-3291s1c1
Sequence:CCGGCCCATCTGATTCTGCTTTCTTCTCGAGAAGAAAGCAGAATCAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-493s1c1
Sequence:CCGGGATTGAGTTCTCCGAGTTCATCTCGAGATGAACTCGGAGAACTCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-712s1c1
Sequence:CCGGCTTTGCCATGATGGACAAGAACTCGAGTTCTTGTCCATCATGGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-490s1c1
Sequence:CCGGCAGGATTGAGTTCTCCGAGTTCTCGAGAACTCGGAGAACTCAATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019681.2-437s1c1
Sequence:CCGGCCCACCAAGTTCGCCACGTTTCTCGAGAAACGTGGCGAACTTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014286
NCS1 MISSION shRNA Bacterial Glycerol Stock
neuronal calcium sensor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-320s1c1
Sequence:CCGGGCGAATTGAGTTCTCCGAGTTCTCGAGAACTCGGAGAACTCAATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-267s1c1
Sequence:CCGGCCCACCAAGTTTGCCACATTTCTCGAGAAATGTGGCAAACTTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-405s1c1
Sequence:CCGGCTCTACGACTTGGACAATGATCTCGAGATCATTGTCCAAGTCGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-230s1c1
Sequence:CCGGCCAGAAGATCTACAAGCAATTCTCGAGAATTGCTTGTAGATCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-140s1c1
Sequence:CCGGGAAGACCTACTTTACCGAGAACTCGAGTTCTCGGTAAAGTAGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014286.3-639s21c1
Sequence:CCGGCTCTACGACGGGCTGGTATAGCTCGAGCTATACCAGCCCGTCGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014286.3-908s21c1
Sequence:CCGGGGCTACAGCCCTCTGCATAAACTCGAGTTTATGCAGAGGGCTGTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014286
NCS1 MISSION shRNA shRNA Plasmid DNA
neuronal calcium sensor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-320s1c1
Sequence:CCGGGCGAATTGAGTTCTCCGAGTTCTCGAGAACTCGGAGAACTCAATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-267s1c1
Sequence:CCGGCCCACCAAGTTTGCCACATTTCTCGAGAAATGTGGCAAACTTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-405s1c1
Sequence:CCGGCTCTACGACTTGGACAATGATCTCGAGATCATTGTCCAAGTCGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-230s1c1
Sequence:CCGGCCAGAAGATCTACAAGCAATTCTCGAGAATTGCTTGTAGATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-140s1c1
Sequence:CCGGGAAGACCTACTTTACCGAGAACTCGAGTTCTCGGTAAAGTAGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014286.3-639s21c1
Sequence:CCGGCTCTACGACGGGCTGGTATAGCTCGAGCTATACCAGCCCGTCGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014286.3-908s21c1
Sequence:CCGGGGCTACAGCCCTCTGCATAAACTCGAGTTTATGCAGAGGGCTGTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014286
NCS1 MISSION shRNA Lentiviral Transduction Particles
neuronal calcium sensor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-320s1c1
Sequence:CCGGGCGAATTGAGTTCTCCGAGTTCTCGAGAACTCGGAGAACTCAATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-267s1c1
Sequence:CCGGCCCACCAAGTTTGCCACATTTCTCGAGAAATGTGGCAAACTTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-405s1c1
Sequence:CCGGCTCTACGACTTGGACAATGATCTCGAGATCATTGTCCAAGTCGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-230s1c1
Sequence:CCGGCCAGAAGATCTACAAGCAATTCTCGAGAATTGCTTGTAGATCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014286.2-140s1c1
Sequence:CCGGGAAGACCTACTTTACCGAGAACTCGAGTTCTCGGTAAAGTAGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014286.3-639s21c1
Sequence:CCGGCTCTACGACGGGCTGGTATAGCTCGAGCTATACCAGCCCGTCGTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014286.3-908s21c1
Sequence:CCGGGGCTACAGCCCTCTGCATAAACTCGAGTTTATGCAGAGGGCTGTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)