EMAIL THIS PAGE TO A FRIEND

NCSTN

nicastrin

97 Gene Product Result for
Synonyms: APH2
UniProtKB ID: Q92542, Q5T207, Q5T208, Q86VV5
Gene ID:
Human(23385) Summary: This gene encodes a Type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Alternatively spliced transcript variants have been described, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(59287) nicastrin
Rat(289231) nicastrin
Zebrafish(494449) nicastrin
cow(514929) nicastrin
Horse(100058515) nicastrin
dog(488638) nicastrin
chicken(426905) nicastrin
sheep(101120457) nicastrin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
545740 (R)-(−)-2-Fluoro-α-methyl-4-biphenylacetic acid 97% human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
BM0005 Avagacestat ≥98% (HPLC) human pricing
PZ0187 Begacestat ≥98% (HPLC) human pricing
D5942 DAPT ≥98% (HPLC), solid human, mouse, rat pricing
L1790 L-685,458 >96% (HPLC), solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015331 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015331 siRNAs that have been validated in the lab human pricing
NM_001034026 Rosetta Predictions rat pricing
NM_001034027 Rosetta Predictions rat pricing
NM_174864 Rosetta Predictions rat pricing
NM_021607 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015331 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171880 validated 722
1 SASI_Hs01_00171881 validated 478
2 SASI_Hs01_00171879 predicted 1547
3 SASI_Hs01_00171882 predicted 1685
4 SASI_Hs01_00171883 predicted 1812
5 SASI_Hs01_00171886 predicted 903
6 SASI_Hs01_00171887 predicted 2322
7 SASI_Hs01_00171888 predicted 896
8 SASI_Hs02_00347631 predicted 401
9 SASI_Hs02_00347632 predicted 1823
10 SASI_Hs02_00347633 predicted 1435
11 SASI_Hs01_00171884 predicted 2194
12 SASI_Hs01_00171885 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063500 predicted 384
2 SASI_Rn01_00063501 predicted 440
3 SASI_Rn01_00063502 predicted 248
4 SASI_Rn01_00063503 predicted 636
5 SASI_Rn01_00063504 predicted 704
6 SASI_Rn01_00063505 predicted 781
7 SASI_Rn01_00063506 predicted 213
8 SASI_Rn01_00063507 predicted 643
9 SASI_Rn01_00063508 predicted 296
10 SASI_Rn01_00063509 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046150 predicted 736
2 SASI_Rn01_00046151 predicted 738
3 SASI_Rn01_00046152 predicted 247
4 SASI_Rn01_00046153 predicted 398
5 SASI_Rn01_00046154 predicted 465
6 SASI_Rn01_00046155 predicted 538
7 SASI_Rn01_00046156 predicted 205
8 SASI_Rn01_00046157 predicted 398
9 SASI_Rn01_00046158 predicted 671
10 SASI_Rn01_00046159 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117922 predicted 1513
2 SASI_Rn01_00117923 predicted 1866
3 SASI_Rn01_00117924 predicted 1720
4 SASI_Rn01_00117925 predicted 1770
5 SASI_Rn02_00269475 predicted 2060
6 SASI_Rn01_00117927 predicted 857
7 SASI_Rn01_00117928 predicted 1199
8 SASI_Rn01_00117929 predicted 2140
9 SASI_Rn01_00117930 predicted 1135
10 SASI_Rn02_00269476 predicted 198
11 SASI_Rn01_00117926 predicted 1363
12 SASI_Rn01_00117931 predicted 1887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326373 predicted 638
2 SASI_Mm01_00052832 predicted 1371
3 SASI_Mm01_00052833 predicted 1770
4 SASI_Mm01_00052834 predicted 1570
5 SASI_Mm01_00052835 predicted 1979
6 SASI_Mm01_00052836 predicted 1106
7 SASI_Mm01_00052839 predicted 421
8 SASI_Mm01_00052840 predicted 1633
9 SASI_Mm01_00052841 predicted 2068
10 SASI_Mm02_00326374 predicted 1579
11 SASI_Mm01_00052837 predicted 1132
12 SASI_Mm01_00052838 predicted 1702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021607
VALIDATED
NCSTN MISSION shRNA Bacterial Glycerol Stock
nicastrin
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021607.2-757s1c1
Sequence:CCGGCCCTTATCTGACTACAACGTACTCGAGTACGTTGTAGTCAGATAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-429s1c1
Sequence:CCGGCCCAAATGATGGGTTTGGTATCTCGAGATACCAAACCCATCATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-1786s21c1
Sequence:CCGGCCAAATGAGAGCAAGGATTTACTCGAGTAAATCCTTGCTCTCATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-1347s21c1
Sequence:CCGGCTCCTTCCACAATCGGTATTACTCGAGTAATACCGATTGTGGAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021607.2-1381s1c1
Sequence:CCGGGACACGGCTGAGAACATTAATCTCGAGATTAATGTTCTCAGCCGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-1347s1c1
Sequence:CCGGCTCCTTCCACAATCGGTATTACTCGAGTAATACCGATTGTGGAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-2544s21c1
Sequence:CCGGCCTGAACCCTTAGGGAAGAAACTCGAGTTTCTTCCCTAAGGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-429s21c1
Sequence:CCGGCCCAAATGATGGGTTTGGTATCTCGAGATACCAAACCCATCATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-2544s1c1
Sequence:CCGGCCTGAACCCTTAGGGAAGAAACTCGAGTTTCTTCCCTAAGGGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-1786s1c1
Sequence:CCGGCCAAATGAGAGCAAGGATTTACTCGAGTAAATCCTTGCTCTCATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-2550s1c1
Sequence:CCGGCCCTTAGGGAAGAAATGGATTCTCGAGAATCCATTTCTTCCCTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021607.2-780s1c1
Sequence:CCGGGAGCATGCTTAAGCCTATAAACTCGAGTTTATAGGCTTAAGCATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021607
VALIDATED
NCSTN MISSION shRNA shRNA Plasmid DNA
nicastrin
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021607.2-757s1c1
Sequence:CCGGCCCTTATCTGACTACAACGTACTCGAGTACGTTGTAGTCAGATAAGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000175556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-429s1c1
Sequence:CCGGCCCAAATGATGGGTTTGGTATCTCGAGATACCAAACCCATCATTTGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000298117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-1786s21c1
Sequence:CCGGCCAAATGAGAGCAAGGATTTACTCGAGTAAATCCTTGCTCTCATTTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000293129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-1347s21c1
Sequence:CCGGCTCCTTCCACAATCGGTATTACTCGAGTAATACCGATTGTGGAAGGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000217288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021607.2-1381s1c1
Sequence:CCGGGACACGGCTGAGAACATTAATCTCGAGATTAATGTTCTCAGCCGTGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000176320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-1347s1c1
Sequence:CCGGCTCCTTCCACAATCGGTATTACTCGAGTAATACCGATTGTGGAAGGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000293130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-2544s21c1
Sequence:CCGGCCTGAACCCTTAGGGAAGAAACTCGAGTTTCTTCCCTAAGGGTTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000293074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-429s21c1
Sequence:CCGGCCCAAATGATGGGTTTGGTATCTCGAGATACCAAACCCATCATTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000174041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-2544s1c1
Sequence:CCGGCCTGAACCCTTAGGGAAGAAACTCGAGTTTCTTCCCTAAGGGTTCAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000174315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-1786s1c1
Sequence:CCGGCCAAATGAGAGCAAGGATTTACTCGAGTAAATCCTTGCTCTCATTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000175359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-2550s1c1
Sequence:CCGGCCCTTAGGGAAGAAATGGATTCTCGAGAATCCATTTCTTCCCTAAGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000216784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021607.2-780s1c1
Sequence:CCGGGAGCATGCTTAAGCCTATAAACTCGAGTTTATAGGCTTAAGCATGCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021607
VALIDATED
NCSTN MISSION shRNA Lentiviral Transduction Particles
nicastrin
Mouse
12 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000193638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021607.2-757s1c1
Sequence:CCGGCCCTTATCTGACTACAACGTACTCGAGTACGTTGTAGTCAGATAAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-429s1c1
Sequence:CCGGCCCAAATGATGGGTTTGGTATCTCGAGATACCAAACCCATCATTTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-1786s21c1
Sequence:CCGGCCAAATGAGAGCAAGGATTTACTCGAGTAAATCCTTGCTCTCATTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-1347s21c1
Sequence:CCGGCTCCTTCCACAATCGGTATTACTCGAGTAATACCGATTGTGGAAGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021607.2-1381s1c1
Sequence:CCGGGACACGGCTGAGAACATTAATCTCGAGATTAATGTTCTCAGCCGTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-1347s1c1
Sequence:CCGGCTCCTTCCACAATCGGTATTACTCGAGTAATACCGATTGTGGAAGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-2544s21c1
Sequence:CCGGCCTGAACCCTTAGGGAAGAAACTCGAGTTTCTTCCCTAAGGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021607.2-429s21c1
Sequence:CCGGCCCAAATGATGGGTTTGGTATCTCGAGATACCAAACCCATCATTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-2544s1c1
Sequence:CCGGCCTGAACCCTTAGGGAAGAAACTCGAGTTTCTTCCCTAAGGGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-1786s1c1
Sequence:CCGGCCAAATGAGAGCAAGGATTTACTCGAGTAAATCCTTGCTCTCATTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021607.2-2550s1c1
Sequence:CCGGCCCTTAGGGAAGAAATGGATTCTCGAGAATCCATTTCTTCCCTAAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021607.2-780s1c1
Sequence:CCGGGAGCATGCTTAAGCCTATAAACTCGAGTTTATAGGCTTAAGCATGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015331
NCSTN MISSION shRNA Bacterial Glycerol Stock
nicastrin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-895s21c1
Sequence:CCGGGAGCATGCTAAAGCCTATAAACTCGAGTTTATAGGCTTTAGCATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-1688s21c1
Sequence:CCGGCTCTATGGGTTCCTGATTAAACTCGAGTTTAATCAGGAACCCATAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015331.2-2537s21c1
Sequence:CCGGCCTAGTTACCCACCCTAATTTCTCGAGAAATTAGGGTGGGTAACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-1985s21c1
Sequence:CCGGGTGCGTTCTACTGCACGATTACTCGAGTAATCGTGCAGTAGAACGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-2046s21c1
Sequence:CCGGGCTCTACTGAATACTCTACATCTCGAGATGTAGAGTATTCAGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015331
NCSTN MISSION shRNA shRNA Plasmid DNA
nicastrin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-895s21c1
Sequence:CCGGGAGCATGCTAAAGCCTATAAACTCGAGTTTATAGGCTTTAGCATGCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-1688s21c1
Sequence:CCGGCTCTATGGGTTCCTGATTAAACTCGAGTTTAATCAGGAACCCATAGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015331.2-2537s21c1
Sequence:CCGGCCTAGTTACCCACCCTAATTTCTCGAGAAATTAGGGTGGGTAACTAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000308211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-1985s21c1
Sequence:CCGGGTGCGTTCTACTGCACGATTACTCGAGTAATCGTGCAGTAGAACGCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000289805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-2046s21c1
Sequence:CCGGGCTCTACTGAATACTCTACATCTCGAGATGTAGAGTATTCAGTAGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015331
NCSTN MISSION shRNA Lentiviral Transduction Particles
nicastrin
Human
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000310276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-895s21c1
Sequence:CCGGGAGCATGCTAAAGCCTATAAACTCGAGTTTATAGGCTTTAGCATGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-1688s21c1
Sequence:CCGGCTCTATGGGTTCCTGATTAAACTCGAGTTTAATCAGGAACCCATAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015331.2-2537s21c1
Sequence:CCGGCCTAGTTACCCACCCTAATTTCTCGAGAAATTAGGGTGGGTAACTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-1985s21c1
Sequence:CCGGGTGCGTTCTACTGCACGATTACTCGAGTAATCGTGCAGTAGAACGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015331.2-2046s21c1
Sequence:CCGGGCTCTACTGAATACTCTACATCTCGAGATGTAGAGTATTCAGTAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)