EMAIL THIS PAGE TO A FRIEND

ND6

mitochondrially encoded NADH dehydrogenase 6

4 Gene Product Result for
Synonyms: MTND6
Gene ID:
Mouse(17722) NADH dehydrogenase subunit 6
Rat(26203) NADH dehydrogenase subunit 6
fruit fly(192479) NADH dehydrogenase subunit 6
Roundworm(2565699) NADH dehydrogenase subunit 6
Domestic Pig(7440890) NADH dehydrogenase subunit 6
cow(3283888) NADH dehydrogenase subunit 6
Horse(807848) NADH dehydrogenase subunit 6
domestic cat(807930) NADH dehydrogenase subunit 6
dog(804485) NADH dehydrogenase subunit 6
chicken(807640) NADH dehydrogenase subunit 6
Zebrafish(140536) NADH dehydrogenase subunit 6
Goat(1485867) NADH dehydrogenase subunit 6
sheep(808259) NADH dehydrogenase subunit 6
naked mole-rat(10201220) NADH dehydrogenase subunit 6
Domestic Rabbit(808223) NADH dehydrogenase subunit 6
domestic guinea pig(808637) NADH dehydrogenase subunit 6
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173714 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173714
ND6 MISSION shRNA Bacterial Glycerol Stock
mitochondrially encoded NADH dehydrogenase 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-114s1c1
Sequence:CCGGCGGGTGTGTTATTATTCTGAACTCGAGTTCAGAATAATAACACACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-214s1c1
Sequence:CCGGGCGATGGCTATTGAGGAGTATCTCGAGATACTCCTCAATAGCCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-334s1c1
Sequence:CCGGGTGGTGGTTGTGGTAAACTTTCTCGAGAAAGTTTACCACAACCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-198s1c1
Sequence:CCGGCTTTGGATATACTACAGCGATCTCGAGATCGCTGTAGTATATCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-188s1c1
Sequence:CCGGTGATGGTTGTCTTTGGATATACTCGAGTATATCCAAAGACAACCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173714
ND6 MISSION shRNA shRNA Plasmid DNA
mitochondrially encoded NADH dehydrogenase 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-114s1c1
Sequence:CCGGCGGGTGTGTTATTATTCTGAACTCGAGTTCAGAATAATAACACACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-214s1c1
Sequence:CCGGGCGATGGCTATTGAGGAGTATCTCGAGATACTCCTCAATAGCCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-334s1c1
Sequence:CCGGGTGGTGGTTGTGGTAAACTTTCTCGAGAAAGTTTACCACAACCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-198s1c1
Sequence:CCGGCTTTGGATATACTACAGCGATCTCGAGATCGCTGTAGTATATCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-188s1c1
Sequence:CCGGTGATGGTTGTCTTTGGATATACTCGAGTATATCCAAAGACAACCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173714
ND6 MISSION shRNA Lentiviral Transduction Particles
mitochondrially encoded NADH dehydrogenase 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-114s1c1
Sequence:CCGGCGGGTGTGTTATTATTCTGAACTCGAGTTCAGAATAATAACACACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-214s1c1
Sequence:CCGGGCGATGGCTATTGAGGAGTATCTCGAGATACTCCTCAATAGCCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-334s1c1
Sequence:CCGGGTGGTGGTTGTGGTAAACTTTCTCGAGAAAGTTTACCACAACCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-198s1c1
Sequence:CCGGCTTTGGATATACTACAGCGATCTCGAGATCGCTGTAGTATATCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173714.1-188s1c1
Sequence:CCGGTGATGGTTGTCTTTGGATATACTCGAGTATATCCAAAGACAACCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)