EMAIL THIS PAGE TO A FRIEND

NDC1

NDC1 transmembrane nucleoporin

65 Gene Product Result for
Synonyms: NET3 TMEM48
UniProtKB ID: Q9BTX1, Q8NB76, Q9H9T6, Q9NSG3, Q9NSG4, Q9NVZ7
Gene ID:
Mouse(72787) NDC1 transmembrane nucleoporin
Rat(362557) NDC1 transmembrane nucleoporin
Thale Cress(830775) NAD(P)H dehydrogenase C1
cow(616114) NDC1 transmembrane nucleoporin
Zebrafish(335236) NDC1 transmembrane nucleoporin
domestic guinea pig(100716231) NDC1 transmembrane nucleoporin
naked mole-rat(101707743) NDC1 transmembrane nucleoporin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028355 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028355 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028355 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018087 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018087 Rosetta Predictions human pricing
NM_001025023 Rosetta Predictions rat pricing
NM_028355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172656 predicted 1655
2 SASI_Hs01_00172657 predicted 281
3 SASI_Hs02_00351260 predicted 1698
4 SASI_Hs01_00172659 predicted 832
5 SASI_Hs01_00172660 predicted 678
6 SASI_Hs01_00172661 predicted 1317
7 SASI_Hs02_00351261 predicted 2294
8 SASI_Hs01_00172662 predicted 1746
9 SASI_Hs01_00172663 predicted 1641
10 SASI_Hs01_00172664 predicted 1327
11 SASI_Hs01_00172658 predicted 307
12 SASI_Hs01_00172665 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044868 predicted 2094
2 SASI_Rn01_00044869 predicted 809
3 SASI_Rn01_00044870 predicted 1511
4 SASI_Rn01_00044871 predicted 499
5 SASI_Rn01_00044872 predicted 1914
6 SASI_Rn01_00044874 predicted 901
7 SASI_Rn02_00202936 predicted 1229
8 SASI_Rn01_00044875 predicted 517
9 SASI_Rn01_00044876 predicted 596
10 SASI_Rn01_00044877 predicted 1011
11 SASI_Rn01_00044873 predicted 1814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112554 predicted 1879
2 SASI_Mm01_00112555 predicted 1465
3 SASI_Mm01_00112556 predicted 823
4 SASI_Mm02_00333729 predicted 1763
5 SASI_Mm01_00112557 predicted 461
6 SASI_Mm01_00112559 predicted 2008
7 SASI_Mm01_00112561 predicted 2061
8 SASI_Mm01_00112562 predicted 870
9 SASI_Mm01_00112563 predicted 833
10 SASI_Mm02_00333730 predicted 1771
11 SASI_Mm01_00112558 predicted 2057
12 SASI_Mm01_00112560 predicted 1237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028355
VALIDATED
NDC1 MISSION shRNA Bacterial Glycerol Stock
NDC1 transmembrane nucleoporin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028355.1-2099s1c1
Sequence:CCGGGTGTTCATTACCCTGCTGATACTCGAGTATCAGCAGGGTAATGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.1-1774s1c1
Sequence:CCGGGCAGCGTCATTTACAGAAGATCTCGAGATCTTCTGTAAATGACGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-2010s21c1
Sequence:CCGGCACTTAGTAGCAGCGTCATTTCTCGAGAAATGACGCTGCTACTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-2406s21c1
Sequence:CCGGAGAAGAGAGCGGACTAATTAGCTCGAGCTAATTAGTCCGCTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.3-1969s1c1
Sequence:CCGGCAGATGCCCAAATGCATATTTCTCGAGAAATATGCATTTGGGCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.3-539s1c1
Sequence:CCGGGGCCGTGGTCATTATAATAATCTCGAGATTATTATAATGACCACGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.3-1384s1c1
Sequence:CCGGCCCACAATTGGACTGCTATTTCTCGAGAAATAGCAGTCCAATTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-880s21c1
Sequence:CCGGATCTCCCGTTTCCTATTATACCTCGAGGTATAATAGGAAACGGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-1384s21c1
Sequence:CCGGCCCACAATTGGACTGCTATTTCTCGAGAAATAGCAGTCCAATTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-1095s21c1
Sequence:CCGGGGTCTCCTGAACGTCTCATTACTCGAGTAATGAGACGTTCAGGAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028355
VALIDATED
NDC1 MISSION shRNA shRNA Plasmid DNA
NDC1 transmembrane nucleoporin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028355.1-2099s1c1
Sequence:CCGGGTGTTCATTACCCTGCTGATACTCGAGTATCAGCAGGGTAATGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.1-1774s1c1
Sequence:CCGGGCAGCGTCATTTACAGAAGATCTCGAGATCTTCTGTAAATGACGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-2010s21c1
Sequence:CCGGCACTTAGTAGCAGCGTCATTTCTCGAGAAATGACGCTGCTACTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-2406s21c1
Sequence:CCGGAGAAGAGAGCGGACTAATTAGCTCGAGCTAATTAGTCCGCTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.3-1969s1c1
Sequence:CCGGCAGATGCCCAAATGCATATTTCTCGAGAAATATGCATTTGGGCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.3-539s1c1
Sequence:CCGGGGCCGTGGTCATTATAATAATCTCGAGATTATTATAATGACCACGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.3-1384s1c1
Sequence:CCGGCCCACAATTGGACTGCTATTTCTCGAGAAATAGCAGTCCAATTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-880s21c1
Sequence:CCGGATCTCCCGTTTCCTATTATACCTCGAGGTATAATAGGAAACGGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-1384s21c1
Sequence:CCGGCCCACAATTGGACTGCTATTTCTCGAGAAATAGCAGTCCAATTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-1095s21c1
Sequence:CCGGGGTCTCCTGAACGTCTCATTACTCGAGTAATGAGACGTTCAGGAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028355
VALIDATED
NDC1 MISSION shRNA Lentiviral Transduction Particles
NDC1 transmembrane nucleoporin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028355.1-2099s1c1
Sequence:CCGGGTGTTCATTACCCTGCTGATACTCGAGTATCAGCAGGGTAATGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.1-1774s1c1
Sequence:CCGGGCAGCGTCATTTACAGAAGATCTCGAGATCTTCTGTAAATGACGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-2010s21c1
Sequence:CCGGCACTTAGTAGCAGCGTCATTTCTCGAGAAATGACGCTGCTACTAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-2406s21c1
Sequence:CCGGAGAAGAGAGCGGACTAATTAGCTCGAGCTAATTAGTCCGCTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.3-1969s1c1
Sequence:CCGGCAGATGCCCAAATGCATATTTCTCGAGAAATATGCATTTGGGCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.3-539s1c1
Sequence:CCGGGGCCGTGGTCATTATAATAATCTCGAGATTATTATAATGACCACGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028355.3-1384s1c1
Sequence:CCGGCCCACAATTGGACTGCTATTTCTCGAGAAATAGCAGTCCAATTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-880s21c1
Sequence:CCGGATCTCCCGTTTCCTATTATACCTCGAGGTATAATAGGAAACGGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-1384s21c1
Sequence:CCGGCCCACAATTGGACTGCTATTTCTCGAGAAATAGCAGTCCAATTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028355.3-1095s21c1
Sequence:CCGGGGTCTCCTGAACGTCTCATTACTCGAGTAATGAGACGTTCAGGAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018087
VALIDATED
NDC1 MISSION shRNA Bacterial Glycerol Stock
NDC1 transmembrane nucleoporin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-835s1c1
Sequence:CCGGGCAATACAAGTTCTTGCGTTTCTCGAGAAACGCAAGAACTTGTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018087.3-1998s1c1
Sequence:CCGGCGACACTACCAGCTATCCTTACTCGAGTAAGGATAGCTGGTAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-1947s1c1
Sequence:CCGGCGCACTTAGTAGCAGCATCATCTCGAGATGATGCTGCTACTAAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-2283s1c1
Sequence:CCGGGTGTTCATTACACTGCTGATACTCGAGTATCAGCAGTGTAATGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-433s1c1
Sequence:CCGGCCTGTATAGTTCCTATGTAATCTCGAGATTACATAGGAACTATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-1656s21c1
Sequence:CCGGCGCAAAGTCCTCAGCTAATAACTCGAGTTATTAGCTGAGGACTTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-1947s21c1
Sequence:CCGGCGCACTTAGTAGCAGCATCATCTCGAGATGATGCTGCTACTAAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-2283s21c1
Sequence:CCGGGTGTTCATTACACTGCTGATACTCGAGTATCAGCAGTGTAATGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018087.3-835s21c1
Sequence:CCGGGCAATACAAGTTCTTGCGTTTCTCGAGAAACGCAAGAACTTGTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-433s21c1
Sequence:CCGGCCTGTATAGTTCCTATGTAATCTCGAGATTACATAGGAACTATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018087
VALIDATED
NDC1 MISSION shRNA shRNA Plasmid DNA
NDC1 transmembrane nucleoporin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-835s1c1
Sequence:CCGGGCAATACAAGTTCTTGCGTTTCTCGAGAAACGCAAGAACTTGTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018087.3-1998s1c1
Sequence:CCGGCGACACTACCAGCTATCCTTACTCGAGTAAGGATAGCTGGTAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-1947s1c1
Sequence:CCGGCGCACTTAGTAGCAGCATCATCTCGAGATGATGCTGCTACTAAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-2283s1c1
Sequence:CCGGGTGTTCATTACACTGCTGATACTCGAGTATCAGCAGTGTAATGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-433s1c1
Sequence:CCGGCCTGTATAGTTCCTATGTAATCTCGAGATTACATAGGAACTATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-1656s21c1
Sequence:CCGGCGCAAAGTCCTCAGCTAATAACTCGAGTTATTAGCTGAGGACTTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-1947s21c1
Sequence:CCGGCGCACTTAGTAGCAGCATCATCTCGAGATGATGCTGCTACTAAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-2283s21c1
Sequence:CCGGGTGTTCATTACACTGCTGATACTCGAGTATCAGCAGTGTAATGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018087.3-835s21c1
Sequence:CCGGGCAATACAAGTTCTTGCGTTTCTCGAGAAACGCAAGAACTTGTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-433s21c1
Sequence:CCGGCCTGTATAGTTCCTATGTAATCTCGAGATTACATAGGAACTATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018087
VALIDATED
NDC1 MISSION shRNA Lentiviral Transduction Particles
NDC1 transmembrane nucleoporin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-835s1c1
Sequence:CCGGGCAATACAAGTTCTTGCGTTTCTCGAGAAACGCAAGAACTTGTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018087.3-1998s1c1
Sequence:CCGGCGACACTACCAGCTATCCTTACTCGAGTAAGGATAGCTGGTAGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-1947s1c1
Sequence:CCGGCGCACTTAGTAGCAGCATCATCTCGAGATGATGCTGCTACTAAGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-2283s1c1
Sequence:CCGGGTGTTCATTACACTGCTGATACTCGAGTATCAGCAGTGTAATGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018087.3-433s1c1
Sequence:CCGGCCTGTATAGTTCCTATGTAATCTCGAGATTACATAGGAACTATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-1656s21c1
Sequence:CCGGCGCAAAGTCCTCAGCTAATAACTCGAGTTATTAGCTGAGGACTTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-1947s21c1
Sequence:CCGGCGCACTTAGTAGCAGCATCATCTCGAGATGATGCTGCTACTAAGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-2283s21c1
Sequence:CCGGGTGTTCATTACACTGCTGATACTCGAGTATCAGCAGTGTAATGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018087.3-835s21c1
Sequence:CCGGGCAATACAAGTTCTTGCGTTTCTCGAGAAACGCAAGAACTTGTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018087.3-433s21c1
Sequence:CCGGCCTGTATAGTTCCTATGTAATCTCGAGATTACATAGGAACTATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)