EMAIL THIS PAGE TO A FRIEND

NDC80

NDC80 kinetochore complex component

59 Gene Product Result for
Synonyms: HEC HEC1 HsHec1 KNTC2 TID3 hsNDC80
UniProtKB ID: O14777, Q6PJX2
Gene ID:
Human(10403) Summary: This gene encodes a component of the NDC80 kinetochore complex. The encoded protein consists of an N-terminal microtubule binding domain and a C-terminal coiled-coiled domain that interacts with other components of the complex. This protein functions to organize and stabilize microtubule-kinetochore interactions and is required for proper chromosome segregation. [provided by RefSeq, Oct 2011]
Mouse(67052) NDC80 homolog, kinetochore complex component (S. cerevisiae)
Rat(301701) NDC80 kinetochore complex component
sheep(101104623) NDC80 kinetochore complex component homolog (S. cerevisiae)
naked mole-rat(101724914) NDC80 kinetochore complex component
Domestic Rabbit(100349582) NDC80 kinetochore complex component homolog (S. cerevisiae)
domestic guinea pig(100717899) NDC80 kinetochore complex component
fruit fly(32316) CG9938 gene product from transcript CG9938-RA
domestic cat(101087946) NDC80 kinetochore complex component homolog (S. cerevisiae)
cow(538789) NDC80 homolog, kinetochore complex component (S. cerevisiae)
Horse(100051228) NDC80 kinetochore complex component homolog (S. cerevisiae)
dog(480190) NDC80 kinetochore complex component homolog (S. cerevisiae)
Zebrafish(445386) NDC80 homolog, kinetochore complex component (S. cerevisiae)
chicken(395134) NDC80 kinetochore complex component homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006101 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023294 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023294 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023294 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006101 Rosetta Predictions human pricing
NM_001126270 Rosetta Predictions rat pricing
NM_023294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138654 predicted 1226
2 SASI_Hs01_00138655 predicted 1185
3 SASI_Hs01_00138656 predicted 299
4 SASI_Hs02_00340886 predicted 1777
5 SASI_Hs01_00138657 predicted 1086
6 SASI_Hs01_00138659 predicted 744
7 SASI_Hs02_00340887 predicted 1177
8 SASI_Hs01_00138660 predicted 450
9 SASI_Hs01_00138662 predicted 352
10 SASI_Hs02_00340888 predicted 832
11 SASI_Hs01_00138658 predicted 1861
12 SASI_Hs01_00138661 predicted 654
13 SASI_Hs01_00138663 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253073 predicted 216
2 SASI_Rn02_00253074 predicted 246
3 SASI_Rn02_00253075 predicted 827
4 SASI_Rn02_00253076 predicted 456
5 SASI_Rn02_00253077 predicted 504
6 SASI_Rn02_00253078 predicted 899
7 SASI_Rn02_00253079 predicted 391
8 SASI_Rn02_00253080 predicted 788
9 SASI_Rn02_00253081 predicted 320
10 SASI_Rn02_00253082 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025012 predicted 300
2 SASI_Mm02_00327031 predicted 816
3 SASI_Mm02_00327032 predicted 1867
4 SASI_Mm02_00327033 predicted 1312
5 SASI_Mm01_00025014 predicted 236
6 SASI_Mm02_00327034 predicted 525
7 SASI_Mm01_00025015 predicted 1848
8 SASI_Mm01_00025016 predicted 1218
9 SASI_Mm01_00025018 predicted 561
10 SASI_Mm01_00025019 predicted 202
11 SASI_Mm01_00025013 predicted 1262
12 SASI_Mm01_00025017 predicted 1867
13 SASI_Mm01_00025020 predicted 708
14 SASI_Mm01_00025021 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006101
NDC80 MISSION shRNA Bacterial Glycerol Stock
NDC80 kinetochore complex component
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006101.2-2072s21c1
Sequence:CCGGTGAGAAGAAAGCTACTCTAATCTCGAGATTAGAGTAGCTTTCTTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006101.2-1305s21c1
Sequence:CCGGGAATTGCAGCAGACTATTAATCTCGAGATTAATAGTCTGCTGCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006101.2-422s21c1
Sequence:CCGGCAAGGACCCGAGACCACTTAACTCGAGTTAAGTGGTCTCGGGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-1194s1c1
Sequence:CCGGGCAGACATTGAGCGAATAAATCTCGAGATTTATTCGCTCAATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-301s1c1
Sequence:CCGGCCCGGAATAGTCAACTTGGTACTCGAGTACCAAGTTGACTATTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-1068s1c1
Sequence:CCGGGCCATTCTTGACCAGAAATTACTCGAGTAATTTCTGGTCAAGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-1467s1c1
Sequence:CCGGGCTCAAGTTTATGTACCTCTTCTCGAGAAGAGGTACATAAACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-302s1c1
Sequence:CCGGCCGGAATAGTCAACTTGGTATCTCGAGATACCAAGTTGACTATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006101
NDC80 MISSION shRNA shRNA Plasmid DNA
NDC80 kinetochore complex component
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006101.2-2072s21c1
Sequence:CCGGTGAGAAGAAAGCTACTCTAATCTCGAGATTAGAGTAGCTTTCTTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006101.2-1305s21c1
Sequence:CCGGGAATTGCAGCAGACTATTAATCTCGAGATTAATAGTCTGCTGCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006101.2-422s21c1
Sequence:CCGGCAAGGACCCGAGACCACTTAACTCGAGTTAAGTGGTCTCGGGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-1194s1c1
Sequence:CCGGGCAGACATTGAGCGAATAAATCTCGAGATTTATTCGCTCAATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-301s1c1
Sequence:CCGGCCCGGAATAGTCAACTTGGTACTCGAGTACCAAGTTGACTATTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-1068s1c1
Sequence:CCGGGCCATTCTTGACCAGAAATTACTCGAGTAATTTCTGGTCAAGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-1467s1c1
Sequence:CCGGGCTCAAGTTTATGTACCTCTTCTCGAGAAGAGGTACATAAACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-302s1c1
Sequence:CCGGCCGGAATAGTCAACTTGGTATCTCGAGATACCAAGTTGACTATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006101
NDC80 MISSION shRNA Lentiviral Transduction Particles
NDC80 kinetochore complex component
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006101.2-2072s21c1
Sequence:CCGGTGAGAAGAAAGCTACTCTAATCTCGAGATTAGAGTAGCTTTCTTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006101.2-1305s21c1
Sequence:CCGGGAATTGCAGCAGACTATTAATCTCGAGATTAATAGTCTGCTGCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006101.2-422s21c1
Sequence:CCGGCAAGGACCCGAGACCACTTAACTCGAGTTAAGTGGTCTCGGGTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-1194s1c1
Sequence:CCGGGCAGACATTGAGCGAATAAATCTCGAGATTTATTCGCTCAATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-301s1c1
Sequence:CCGGCCCGGAATAGTCAACTTGGTACTCGAGTACCAAGTTGACTATTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-1068s1c1
Sequence:CCGGGCCATTCTTGACCAGAAATTACTCGAGTAATTTCTGGTCAAGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-1467s1c1
Sequence:CCGGGCTCAAGTTTATGTACCTCTTCTCGAGAAGAGGTACATAAACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006101.1-302s1c1
Sequence:CCGGCCGGAATAGTCAACTTGGTATCTCGAGATACCAAGTTGACTATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023294
NDC80 MISSION shRNA Bacterial Glycerol Stock
NDC80 kinetochore complex component
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-474s21c1
Sequence:CCGGCGGTTATGTGTATAGTGTATCCTCGAGGATACACTATACACATAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-1209s21c1
Sequence:CCGGACTACAGAGTATCGTTGATAACTCGAGTTATCAACGATACTCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-437s21c1
Sequence:CCGGAGTGTATTCGACAACTCTATGCTCGAGCATAGAGTTGTCGAATACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-1278s21c1
Sequence:CCGGTGAATTGCAGCAGACTATTAACTCGAGTTAATAGTCTGCTGCAATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-1246s21c1
Sequence:CCGGGCTGACATTGAGAGAATAAATCTCGAGATTTATTCTCTCAATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-1259s1c1
Sequence:CCGGGCTGACATTGAGAGAATAAATCTCGAGATTTATTCTCTCAATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-1258s1c1
Sequence:CCGGCGCTGACATTGAGAGAATAAACTCGAGTTTATTCTCTCAATGTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-582s1c1
Sequence:CCGGCGTCGTATGAACTTCCTGGTACTCGAGTACCAGGAAGTTCATACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-585s1c1
Sequence:CCGGCGTATGAACTTCCTGGTACAACTCGAGTTGTACCAGGAAGTTCATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-1070s1c1
Sequence:CCGGGCGTCCTTACAAGCAGATGTTCTCGAGAACATCTGCTTGTAAGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023294
NDC80 MISSION shRNA shRNA Plasmid DNA
NDC80 kinetochore complex component
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-474s21c1
Sequence:CCGGCGGTTATGTGTATAGTGTATCCTCGAGGATACACTATACACATAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-1209s21c1
Sequence:CCGGACTACAGAGTATCGTTGATAACTCGAGTTATCAACGATACTCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-437s21c1
Sequence:CCGGAGTGTATTCGACAACTCTATGCTCGAGCATAGAGTTGTCGAATACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-1278s21c1
Sequence:CCGGTGAATTGCAGCAGACTATTAACTCGAGTTAATAGTCTGCTGCAATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-1246s21c1
Sequence:CCGGGCTGACATTGAGAGAATAAATCTCGAGATTTATTCTCTCAATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-1259s1c1
Sequence:CCGGGCTGACATTGAGAGAATAAATCTCGAGATTTATTCTCTCAATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-1258s1c1
Sequence:CCGGCGCTGACATTGAGAGAATAAACTCGAGTTTATTCTCTCAATGTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-582s1c1
Sequence:CCGGCGTCGTATGAACTTCCTGGTACTCGAGTACCAGGAAGTTCATACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-585s1c1
Sequence:CCGGCGTATGAACTTCCTGGTACAACTCGAGTTGTACCAGGAAGTTCATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-1070s1c1
Sequence:CCGGGCGTCCTTACAAGCAGATGTTCTCGAGAACATCTGCTTGTAAGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023294
NDC80 MISSION shRNA Lentiviral Transduction Particles
NDC80 kinetochore complex component
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-474s21c1
Sequence:CCGGCGGTTATGTGTATAGTGTATCCTCGAGGATACACTATACACATAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-1209s21c1
Sequence:CCGGACTACAGAGTATCGTTGATAACTCGAGTTATCAACGATACTCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-437s21c1
Sequence:CCGGAGTGTATTCGACAACTCTATGCTCGAGCATAGAGTTGTCGAATACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-1278s21c1
Sequence:CCGGTGAATTGCAGCAGACTATTAACTCGAGTTAATAGTCTGCTGCAATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023294.2-1246s21c1
Sequence:CCGGGCTGACATTGAGAGAATAAATCTCGAGATTTATTCTCTCAATGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-1259s1c1
Sequence:CCGGGCTGACATTGAGAGAATAAATCTCGAGATTTATTCTCTCAATGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-1258s1c1
Sequence:CCGGCGCTGACATTGAGAGAATAAACTCGAGTTTATTCTCTCAATGTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-582s1c1
Sequence:CCGGCGTCGTATGAACTTCCTGGTACTCGAGTACCAGGAAGTTCATACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-585s1c1
Sequence:CCGGCGTATGAACTTCCTGGTACAACTCGAGTTGTACCAGGAAGTTCATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023294.1-1070s1c1
Sequence:CCGGGCGTCCTTACAAGCAGATGTTCTCGAGAACATCTGCTTGTAAGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)