EMAIL THIS PAGE TO A FRIEND

NDE1

nudE neurodevelopment protein 1

104 Gene Product Result for
Synonyms: HOM-TES-87 LIS4 NDE NUDE NUDE1
UniProtKB ID: Q9NXR1, Q49AQ2
Gene ID:
Human(54820) Summary: This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Mouse(67203) nuclear distribution gene E homolog 1 (A nidulans)
Rat(83836) nudE neurodevelopment protein 1
Zebrafish(566146) nudE nuclear distribution gene E homolog 1 (A. nidulans)
chicken(416597) nudE nuclear distribution E homolog 1 (A. nidulans)
cow(508088) nudE nuclear distribution gene E homolog 1 (A. nidulans)
domestic cat(101098423) nudE nuclear distribution E homolog 1 (A. nidulans)
dog(100684378) nudE nuclear distribution E homolog 1 (A. nidulans)
domestic guinea pig(100714890) nudE nuclear distribution E homolog 1 (A. nidulans)
naked mole-rat(101720925) nudE nuclear distribution E homolog 1 (A. nidulans)
sheep(101114156) nudE nuclear distribution E homolog 1 (A. nidulans)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017668 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001114085 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001114085 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001114085 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017668 Rosetta Predictions human pricing
NM_053347 Rosetta Predictions rat pricing
NM_001114085 Rosetta Predictions mouse pricing
NM_023317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074363 predicted 504
2 SASI_Hs01_00074364 predicted 534
3 SASI_Hs01_00074365 predicted 471
4 SASI_Hs01_00074366 predicted 397
5 SASI_Hs01_00074367 predicted 911
6 SASI_Hs01_00074368 predicted 332
7 SASI_Hs01_00074369 predicted 406
8 SASI_Hs01_00074370 predicted 831
9 SASI_Hs01_00074371 predicted 477
10 SASI_Hs01_00074372 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106157 predicted 1525
2 SASI_Rn01_00106158 predicted 313
3 SASI_Rn01_00106159 predicted 813
4 SASI_Rn01_00106160 predicted 402
5 SASI_Rn01_00106161 predicted 746
6 SASI_Rn01_00106162 predicted 413
7 SASI_Rn02_00265805 predicted 1354
8 SASI_Rn01_00106163 predicted 1347
9 SASI_Rn01_00106164 predicted 633
10 SASI_Rn01_00106165 predicted 1343
11 SASI_Rn01_00106166 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308329 predicted 790
2 SASI_Mm02_00308330 predicted 791
3 SASI_Mm02_00308331 predicted 391
4 SASI_Mm02_00308332 predicted 287
5 SASI_Mm02_00308333 predicted 538
6 SASI_Mm02_00308334 predicted 371
7 SASI_Mm02_00308335 predicted 1372
8 SASI_Mm02_00308336 predicted 1365
9 SASI_Mm02_00308337 predicted 474
10 SASI_Mm02_00308338 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327045 predicted 795
2 SASI_Mm02_00327046 predicted 794
3 SASI_Mm02_00327047 predicted 395
4 SASI_Mm02_00327048 predicted 286
5 SASI_Mm01_00136362 predicted 542
6 SASI_Mm02_00327049 predicted 370
7 SASI_Mm02_00327050 predicted 209
8 SASI_Mm02_00327051 predicted 475
9 SASI_Mm02_00327052 predicted 771
10 SASI_Mm02_00327053 predicted 542
11 SASI_Mm01_00136357 predicted 1000
12 SASI_Mm01_00136358 predicted 1348
13 SASI_Mm01_00136359 predicted 1015
14 SASI_Mm01_00136360 predicted 1390
15 SASI_Mm01_00136361 predicted 805
16 SASI_Mm01_00136363 predicted 1158
17 SASI_Mm01_00136364 predicted 974
18 SASI_Mm01_00136365 predicted 933
19 SASI_Mm01_00136366 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017668
VALIDATED
NDE1 MISSION shRNA Bacterial Glycerol Stock
nudE neurodevelopment protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017668.1-131s1c1
Sequence:CCGGGAAGCTAACTATTGGAAAGATCTCGAGATCTTTCCAATAGTTAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017668.1-839s1c1
Sequence:CCGGCGGATATCAGCCCTCAACATTCTCGAGAATGTTGAGGGCTGATATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017668.1-749s21c1
Sequence:CCGGCGAGGACCCAGCTCAAGTTTACTCGAGTAAACTTGAGCTGGGTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_017668.1-840s21c1
Sequence:CCGGGGATATCAGCCCTCAACATTGCTCGAGCAATGTTGAGGGCTGATATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017668.1-1351s21c1
Sequence:CCGGCCTCGTTGGAGAAACCCAATACTCGAGTATTGGGTTTCTCCAACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017668.1-150s21c1
Sequence:CCGGATCTGGCGATGACCTACAAACCTCGAGGTTTGTAGGTCATCGCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017668.1-123s21c1
Sequence:CCGGAGGAGGAAGAAGCTAACTATTCTCGAGAATAGTTAGCTTCTTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017668
VALIDATED
NDE1 MISSION shRNA shRNA Plasmid DNA
nudE neurodevelopment protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017668.1-131s1c1
Sequence:CCGGGAAGCTAACTATTGGAAAGATCTCGAGATCTTTCCAATAGTTAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017668.1-839s1c1
Sequence:CCGGCGGATATCAGCCCTCAACATTCTCGAGAATGTTGAGGGCTGATATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017668.1-749s21c1
Sequence:CCGGCGAGGACCCAGCTCAAGTTTACTCGAGTAAACTTGAGCTGGGTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_017668.1-840s21c1
Sequence:CCGGGGATATCAGCCCTCAACATTGCTCGAGCAATGTTGAGGGCTGATATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017668.1-1351s21c1
Sequence:CCGGCCTCGTTGGAGAAACCCAATACTCGAGTATTGGGTTTCTCCAACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017668.1-150s21c1
Sequence:CCGGATCTGGCGATGACCTACAAACCTCGAGGTTTGTAGGTCATCGCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017668.1-123s21c1
Sequence:CCGGAGGAGGAAGAAGCTAACTATTCTCGAGAATAGTTAGCTTCTTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017668
VALIDATED
NDE1 MISSION shRNA Lentiviral Transduction Particles
nudE neurodevelopment protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017668.1-131s1c1
Sequence:CCGGGAAGCTAACTATTGGAAAGATCTCGAGATCTTTCCAATAGTTAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017668.1-839s1c1
Sequence:CCGGCGGATATCAGCCCTCAACATTCTCGAGAATGTTGAGGGCTGATATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017668.1-749s21c1
Sequence:CCGGCGAGGACCCAGCTCAAGTTTACTCGAGTAAACTTGAGCTGGGTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_017668.1-840s21c1
Sequence:CCGGGGATATCAGCCCTCAACATTGCTCGAGCAATGTTGAGGGCTGATATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017668.1-1351s21c1
Sequence:CCGGCCTCGTTGGAGAAACCCAATACTCGAGTATTGGGTTTCTCCAACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017668.1-150s21c1
Sequence:CCGGATCTGGCGATGACCTACAAACCTCGAGGTTTGTAGGTCATCGCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017668.1-123s21c1
Sequence:CCGGAGGAGGAAGAAGCTAACTATTCTCGAGAATAGTTAGCTTCTTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114085
VALIDATED
NDE1 MISSION shRNA Bacterial Glycerol Stock
nudE neurodevelopment protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114085.1-879s21c1
Sequence:CCGGAGCCCGGATATCAGCCCTAAACTCGAGTTTAGGGCTGATATCCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114085.1-194s21c1
Sequence:CCGGACCTGGCCATGACCTACAAACCTCGAGGTTTGTAGGTCATGGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001114085.1-458s21c1
Sequence:CCGGACCAACTGCAGAAATACATTACTCGAGTAATGTATTTCTGCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001114085.1-1054s21c1
Sequence:CCGGAGTACCAGTGTGGGCGATAAACTCGAGTTTATCGCCCACACTGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001114085.1-1382s21c1
Sequence:CCGGCTTCACTGGCTACTAACTTATCTCGAGATAAGTTAGTAGCCAGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114085
VALIDATED
NDE1 MISSION shRNA shRNA Plasmid DNA
nudE neurodevelopment protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114085.1-879s21c1
Sequence:CCGGAGCCCGGATATCAGCCCTAAACTCGAGTTTAGGGCTGATATCCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114085.1-194s21c1
Sequence:CCGGACCTGGCCATGACCTACAAACCTCGAGGTTTGTAGGTCATGGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001114085.1-458s21c1
Sequence:CCGGACCAACTGCAGAAATACATTACTCGAGTAATGTATTTCTGCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001114085.1-1054s21c1
Sequence:CCGGAGTACCAGTGTGGGCGATAAACTCGAGTTTATCGCCCACACTGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001114085.1-1382s21c1
Sequence:CCGGCTTCACTGGCTACTAACTTATCTCGAGATAAGTTAGTAGCCAGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114085
VALIDATED
NDE1 MISSION shRNA Lentiviral Transduction Particles
nudE neurodevelopment protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114085.1-879s21c1
Sequence:CCGGAGCCCGGATATCAGCCCTAAACTCGAGTTTAGGGCTGATATCCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114085.1-194s21c1
Sequence:CCGGACCTGGCCATGACCTACAAACCTCGAGGTTTGTAGGTCATGGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001114085.1-458s21c1
Sequence:CCGGACCAACTGCAGAAATACATTACTCGAGTAATGTATTTCTGCAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001114085.1-1054s21c1
Sequence:CCGGAGTACCAGTGTGGGCGATAAACTCGAGTTTATCGCCCACACTGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001114085.1-1382s21c1
Sequence:CCGGCTTCACTGGCTACTAACTTATCTCGAGATAAGTTAGTAGCCAGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)