EMAIL THIS PAGE TO A FRIEND

NDEL1

nudE neurodevelopment protein 1-like 1

181 Gene Product Result for
Synonyms: EOPA MITAP1 NDE1L1 NDE2 NUDEL
Gene ID:
Human(81565) Summary: This gene encodes a coiled-coil protein that plays a role in multiple processes including cytoskeletal organization, cell signaling and neuron migration, outgrowth and maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, Mar 2012]
Mouse(83431) nuclear distribution gene E-like homolog 1 (A. nidulans)
Rat(170845) nudE nuclear distribution gene E homolog (A. nidulans)-like 1
chicken(417317) nudE nuclear distribution E homolog (A. nidulans)-like 1
dog(489495) nudE nuclear distribution E homolog (A. nidulans)-like 1
Horse(100062671) nudE nuclear distribution E homolog (A. nidulans)-like 1
cow(510769) nudE nuclear distribution gene E homolog (A. nidulans)-like 1
domestic cat(101082448) nudE nuclear distribution E homolog (A. nidulans)-like 1
sheep(101108583) nudE nuclear distribution E homolog (A. nidulans)-like 1
naked mole-rat(101717703) nudE nuclear distribution E homolog (A. nidulans)-like 1
Domestic Rabbit(100008657) nudE nuclear distribution E homolog (A. nidulans)-like 1
domestic guinea pig(100728958) nudE nuclear distribution E homolog (A. nidulans)-like 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090451 MISSION® esiRNA esiRNA human NDEL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025579 Rosetta Predictions human pricing
NM_030808 Rosetta Predictions human pricing
NM_133320 Rosetta Predictions rat pricing
NM_023668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228104 predicted 706
2 SASI_Hs01_00228105 predicted 437
3 SASI_Hs01_00228108 predicted 505
4 SASI_Hs01_00228110 predicted 524
5 SASI_Hs01_00228111 predicted 740
6 SASI_Hs01_00228113 predicted 378
7 SASI_Hs02_00307463 predicted 855
8 SASI_Hs02_00307464 predicted 448
9 SASI_Hs02_00307465 predicted 426
10 SASI_Hs02_00307466 predicted 602
11 SASI_Hs01_00228106 predicted 703
12 SASI_Hs01_00228107 predicted 489
13 SASI_Hs01_00228109 predicted 921
14 SASI_Hs01_00228112 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234678 predicted 707
2 SASI_Hs01_00234679 predicted 434
3 SASI_Hs01_00234682 predicted 509
4 SASI_Hs01_00234684 predicted 525
5 SASI_Hs01_00234685 predicted 742
6 SASI_Hs01_00234687 predicted 380
7 SASI_Hs02_00358379 predicted 859
8 SASI_Hs02_00358380 predicted 445
9 SASI_Hs02_00358381 predicted 423
10 SASI_Hs02_00358382 predicted 601
11 SASI_Hs01_00234680 predicted 709
12 SASI_Hs01_00234681 predicted 484
13 SASI_Hs01_00234683 predicted 920
14 SASI_Hs01_00234686 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058711 predicted 340
2 SASI_Rn01_00058712 predicted 469
3 SASI_Rn01_00058713 predicted 321
4 SASI_Rn01_00058714 predicted 565
5 SASI_Rn01_00058715 predicted 291
6 SASI_Rn01_00058716 predicted 777
7 SASI_Rn01_00058718 predicted 284
8 SASI_Rn02_00267628 predicted 528
9 SASI_Rn01_00058719 predicted 201
10 SASI_Rn02_00267629 predicted 480
11 SASI_Rn01_00058710 predicted 811
12 SASI_Rn01_00058717 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138340 predicted 333
2 SASI_Mm01_00138341 predicted 441
3 SASI_Mm01_00138342 predicted 538
4 SASI_Mm01_00138343 predicted 393
5 SASI_Mm01_00138344 predicted 854
6 SASI_Mm01_00138345 predicted 584
7 SASI_Mm01_00138346 predicted 326
8 SASI_Mm01_00138347 predicted 862
9 SASI_Mm01_00138348 predicted 420
10 SASI_Mm02_00327289 predicted 358
11 SASI_Mm01_00138339 predicted 582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030808
VALIDATED
NDEL1 MISSION shRNA Bacterial Glycerol Stock
nudE neurodevelopment protein 1-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030808.3-1481s21c1
Sequence:CCGGGGGTCGCAAGGTGATACATACCTCGAGGTATGTATCACCTTGCGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030808.3-416s21c1
Sequence:CCGGATATGAAGTGGAGGCATTAAACTCGAGTTTAATGCCTCCACTTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030808.3-891s21c1
Sequence:CCGGCCGAAAGCTATACCAAATGGTCTCGAGACCATTTGGTATAGCTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030808.3-501s21c1
Sequence:CCGGAGTCAGACTCGGGCCATTAAGCTCGAGCTTAATGGCCCGAGTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030808.3-343s21c1
Sequence:CCGGCAGAGTTGGAGGCACAATTAGCTCGAGCTAATTGTGCCTCCAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030808.2-747s1c1
Sequence:CCGGCGGGAAAGACAACAGGAAGTACTCGAGTACTTCCTGTTGTCTTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030808.2-2113s1c1
Sequence:CCGGGCATCCTTTGATTACTCTCATCTCGAGATGAGAGTAATCAAAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030808.2-891s1c1
Sequence:CCGGCCGAAAGCTATACCAAATGGTCTCGAGACCATTTGGTATAGCTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030808.2-1971s1c1
Sequence:CCGGCCTTCAGTTCAACGACATCTTCTCGAGAAGATGTCGTTGAACTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030808.2-1968s1c1
Sequence:CCGGCGTCCTTCAGTTCAACGACATCTCGAGATGTCGTTGAACTGAAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030808
VALIDATED
NDEL1 MISSION shRNA shRNA Plasmid DNA
nudE neurodevelopment protein 1-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030808.3-1481s21c1
Sequence:CCGGGGGTCGCAAGGTGATACATACCTCGAGGTATGTATCACCTTGCGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030808.3-416s21c1
Sequence:CCGGATATGAAGTGGAGGCATTAAACTCGAGTTTAATGCCTCCACTTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030808.3-891s21c1
Sequence:CCGGCCGAAAGCTATACCAAATGGTCTCGAGACCATTTGGTATAGCTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030808.3-501s21c1
Sequence:CCGGAGTCAGACTCGGGCCATTAAGCTCGAGCTTAATGGCCCGAGTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030808.3-343s21c1
Sequence:CCGGCAGAGTTGGAGGCACAATTAGCTCGAGCTAATTGTGCCTCCAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030808.2-747s1c1
Sequence:CCGGCGGGAAAGACAACAGGAAGTACTCGAGTACTTCCTGTTGTCTTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030808.2-2113s1c1
Sequence:CCGGGCATCCTTTGATTACTCTCATCTCGAGATGAGAGTAATCAAAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030808.2-891s1c1
Sequence:CCGGCCGAAAGCTATACCAAATGGTCTCGAGACCATTTGGTATAGCTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030808.2-1971s1c1
Sequence:CCGGCCTTCAGTTCAACGACATCTTCTCGAGAAGATGTCGTTGAACTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030808.2-1968s1c1
Sequence:CCGGCGTCCTTCAGTTCAACGACATCTCGAGATGTCGTTGAACTGAAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030808
VALIDATED
NDEL1 MISSION shRNA Lentiviral Transduction Particles
nudE neurodevelopment protein 1-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030808.3-1481s21c1
Sequence:CCGGGGGTCGCAAGGTGATACATACCTCGAGGTATGTATCACCTTGCGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030808.3-416s21c1
Sequence:CCGGATATGAAGTGGAGGCATTAAACTCGAGTTTAATGCCTCCACTTCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030808.3-891s21c1
Sequence:CCGGCCGAAAGCTATACCAAATGGTCTCGAGACCATTTGGTATAGCTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030808.3-501s21c1
Sequence:CCGGAGTCAGACTCGGGCCATTAAGCTCGAGCTTAATGGCCCGAGTCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030808.3-343s21c1
Sequence:CCGGCAGAGTTGGAGGCACAATTAGCTCGAGCTAATTGTGCCTCCAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030808.2-747s1c1
Sequence:CCGGCGGGAAAGACAACAGGAAGTACTCGAGTACTTCCTGTTGTCTTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030808.2-2113s1c1
Sequence:CCGGGCATCCTTTGATTACTCTCATCTCGAGATGAGAGTAATCAAAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030808.2-891s1c1
Sequence:CCGGCCGAAAGCTATACCAAATGGTCTCGAGACCATTTGGTATAGCTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030808.2-1971s1c1
Sequence:CCGGCCTTCAGTTCAACGACATCTTCTCGAGAAGATGTCGTTGAACTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030808.2-1968s1c1
Sequence:CCGGCGTCCTTCAGTTCAACGACATCTCGAGATGTCGTTGAACTGAAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023668
VALIDATED
NDEL1 MISSION shRNA Bacterial Glycerol Stock
nudE neurodevelopment protein 1-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-1502s21c1
Sequence:CCGGTTGCTGTGCTGATAGGATTTACTCGAGTAAATCCTATCAGCACAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023668.1-627s21c1
Sequence:CCGGGTCTCAGTACAGAGGTTAAAGCTCGAGCTTTAACCTCTGTACTGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-975s21c1
Sequence:CCGGGCATCCCGCAAATCTTATGTTCTCGAGAACATAAGATTTGCGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-1055s21c1
Sequence:CCGGGCGAGCAACTTTCTTCCATAACTCGAGTTATGGAAGAAAGTTGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-353s21c1
Sequence:CCGGGTATGAAGTGGAGGCGTTAAACTCGAGTTTAACGCCTCCACTTCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023668.1-975s1c1
Sequence:CCGGGCATCCCGCAAATCTTATGTTCTCGAGAACATAAGATTTGCGGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023668.1-1055s1c1
Sequence:CCGGGCGAGCAACTTTCTTCCATAACTCGAGTTATGGAAGAAAGTTGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023668.1-198s1c1
Sequence:CCGGCTTTCCTTGAAGTATAAGCAACTCGAGTTGCTTATACTTCAAGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023668.1-1348s1c1
Sequence:CCGGGCGATATCAATACTGGCTATTCTCGAGAATAGCCAGTATTGATATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023668
VALIDATED
NDEL1 MISSION shRNA shRNA Plasmid DNA
nudE neurodevelopment protein 1-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-1502s21c1
Sequence:CCGGTTGCTGTGCTGATAGGATTTACTCGAGTAAATCCTATCAGCACAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023668.1-627s21c1
Sequence:CCGGGTCTCAGTACAGAGGTTAAAGCTCGAGCTTTAACCTCTGTACTGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-975s21c1
Sequence:CCGGGCATCCCGCAAATCTTATGTTCTCGAGAACATAAGATTTGCGGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-1055s21c1
Sequence:CCGGGCGAGCAACTTTCTTCCATAACTCGAGTTATGGAAGAAAGTTGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-353s21c1
Sequence:CCGGGTATGAAGTGGAGGCGTTAAACTCGAGTTTAACGCCTCCACTTCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023668.1-975s1c1
Sequence:CCGGGCATCCCGCAAATCTTATGTTCTCGAGAACATAAGATTTGCGGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023668.1-1055s1c1
Sequence:CCGGGCGAGCAACTTTCTTCCATAACTCGAGTTATGGAAGAAAGTTGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023668.1-198s1c1
Sequence:CCGGCTTTCCTTGAAGTATAAGCAACTCGAGTTGCTTATACTTCAAGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023668.1-1348s1c1
Sequence:CCGGGCGATATCAATACTGGCTATTCTCGAGAATAGCCAGTATTGATATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023668
VALIDATED
NDEL1 MISSION shRNA Lentiviral Transduction Particles
nudE neurodevelopment protein 1-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-1502s21c1
Sequence:CCGGTTGCTGTGCTGATAGGATTTACTCGAGTAAATCCTATCAGCACAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023668.1-627s21c1
Sequence:CCGGGTCTCAGTACAGAGGTTAAAGCTCGAGCTTTAACCTCTGTACTGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-975s21c1
Sequence:CCGGGCATCCCGCAAATCTTATGTTCTCGAGAACATAAGATTTGCGGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-1055s21c1
Sequence:CCGGGCGAGCAACTTTCTTCCATAACTCGAGTTATGGAAGAAAGTTGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023668.1-353s21c1
Sequence:CCGGGTATGAAGTGGAGGCGTTAAACTCGAGTTTAACGCCTCCACTTCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023668.1-975s1c1
Sequence:CCGGGCATCCCGCAAATCTTATGTTCTCGAGAACATAAGATTTGCGGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023668.1-1055s1c1
Sequence:CCGGGCGAGCAACTTTCTTCCATAACTCGAGTTATGGAAGAAAGTTGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023668.1-198s1c1
Sequence:CCGGCTTTCCTTGAAGTATAAGCAACTCGAGTTGCTTATACTTCAAGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023668.1-1348s1c1
Sequence:CCGGGCGATATCAATACTGGCTATTCTCGAGAATAGCCAGTATTGATATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)