EMAIL THIS PAGE TO A FRIEND

NDFIP1

Nedd4 family interacting protein 1

54 Gene Product Result for
Synonyms: N4WBP5
UniProtKB ID: Q9BT67, B2RDB8, D3DQF0, Q658T8, Q8N2E3, Q8N2F9
Gene ID:
Human(80762) Summary: The protein encoded by this gene belongs to a small group of evolutionarily conserved proteins with three transmembrane domains. It is a potential target for ubiquitination by the Nedd4 family of proteins. This protein is thought to be part of a family of integral Golgi membrane proteins. [provided by RefSeq, Jul 2008]
Mouse(65113) Nedd4 family interacting protein 1
Rat(291609) Nedd4 family interacting protein 1
Zebrafish(324047) Nedd4 family interacting protein 1
dog(478044) Nedd4 family interacting protein 1
cow(541196) Nedd4 family interacting protein 1
domestic cat(101080260) Nedd4 family interacting protein 1
chicken(416342) Nedd4 family interacting protein 1
domestic guinea pig(100726594) Nedd4 family interacting protein 1
naked mole-rat(101715734) Nedd4 family interacting protein 1
sheep(101106327) Nedd4 family interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030571 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU161901 MISSION® esiRNA esiRNA targeting mouse Ndfip1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030571 Rosetta Predictions human pricing
NM_001013059 Rosetta Predictions rat pricing
NM_022996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042952 predicted 899
2 SASI_Hs01_00042953 predicted 1134
3 SASI_Hs01_00042954 predicted 1059
4 SASI_Hs01_00042955 predicted 970
5 SASI_Hs02_00358138 predicted 795
6 SASI_Hs02_00358139 predicted 975
7 SASI_Hs01_00042957 predicted 1112
8 SASI_Hs01_00042958 predicted 428
9 SASI_Hs01_00042960 predicted 712
10 SASI_Hs01_00042961 predicted 660
11 SASI_Hs01_00042956 predicted 428
12 SASI_Hs01_00042959 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055709 predicted 1022
2 SASI_Rn01_00055710 predicted 714
3 SASI_Rn01_00055711 predicted 882
4 SASI_Rn01_00055713 predicted 819
5 SASI_Rn01_00055714 predicted 983
6 SASI_Rn01_00055715 predicted 990
7 SASI_Rn01_00055716 predicted 932
8 SASI_Rn01_00055717 predicted 505
9 SASI_Rn01_00055718 predicted 635
10 SASI_Rn02_00200678 predicted 602
11 SASI_Rn01_00055712 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157404 predicted 354
2 SASI_Mm01_00157405 predicted 300
3 SASI_Mm01_00157406 predicted 382
4 SASI_Mm01_00157407 predicted 343
5 SASI_Mm01_00157408 predicted 270
6 SASI_Mm01_00157409 predicted 464
7 SASI_Mm01_00157410 predicted 506
8 SASI_Mm01_00157411 predicted 307
9 SASI_Mm01_00157413 predicted 386
10 SASI_Mm02_00326727 predicted 509
11 SASI_Mm01_00157412 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030571
VALIDATED
NDFIP1 MISSION shRNA Bacterial Glycerol Stock
Nedd4 family interacting protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030571.2-662s1c1
Sequence:CCGGCCATTTCAGGATTTGGTCTCTCTCGAGAGAGACCAAATCCTGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030571.2-2067s1c1
Sequence:CCGGGCACAAGAAGTCCTCTTATATCTCGAGATATAAGAGGACTTCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_030571.2-831s1c1
Sequence:CCGGGCCAGAAACTTTCTCAAATCTCTCGAGAGATTTGAGAAAGTTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030571.2-820s1c1
Sequence:CCGGGTTCGGAAGATGCCAGAAACTCTCGAGAGTTTCTGGCATCTTCCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030571.2-1949s1c1
Sequence:CCGGGCTTAATTTCTTGGCTTGCATCTCGAGATGCAAGCCAAGAAATTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030571.2-668s1c1
Sequence:CCGGCAGGATTTGGTCTCTCTCTAACTCGAGTTAGAGAGAGACCAAATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030571.2-469s1c1
Sequence:CCGGGAAGCTACTATCCCTTTGGTTCTCGAGAACCAAAGGGATAGTAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-831s21c1
Sequence:CCGGGCCAGAAACTTTCTCAAATCTCTCGAGAGATTTGAGAAAGTTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-820s21c1
Sequence:CCGGGTTCGGAAGATGCCAGAAACTCTCGAGAGTTTCTGGCATCTTCCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-1033s21c1
Sequence:CCGGCTATTTGTTCCTAGGTGTAAACTCGAGTTTACACCTAGGAACAAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-662s21c1
Sequence:CCGGCCATTTCAGGATTTGGTCTCTCTCGAGAGAGACCAAATCCTGAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-354s21c1
Sequence:CCGGTGCAGAGAGCGCAGCATATTTCTCGAGAAATATGCTGCGCTCTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030571
VALIDATED
NDFIP1 MISSION shRNA shRNA Plasmid DNA
Nedd4 family interacting protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030571.2-662s1c1
Sequence:CCGGCCATTTCAGGATTTGGTCTCTCTCGAGAGAGACCAAATCCTGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030571.2-2067s1c1
Sequence:CCGGGCACAAGAAGTCCTCTTATATCTCGAGATATAAGAGGACTTCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_030571.2-831s1c1
Sequence:CCGGGCCAGAAACTTTCTCAAATCTCTCGAGAGATTTGAGAAAGTTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030571.2-820s1c1
Sequence:CCGGGTTCGGAAGATGCCAGAAACTCTCGAGAGTTTCTGGCATCTTCCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030571.2-1949s1c1
Sequence:CCGGGCTTAATTTCTTGGCTTGCATCTCGAGATGCAAGCCAAGAAATTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030571.2-668s1c1
Sequence:CCGGCAGGATTTGGTCTCTCTCTAACTCGAGTTAGAGAGAGACCAAATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030571.2-469s1c1
Sequence:CCGGGAAGCTACTATCCCTTTGGTTCTCGAGAACCAAAGGGATAGTAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-831s21c1
Sequence:CCGGGCCAGAAACTTTCTCAAATCTCTCGAGAGATTTGAGAAAGTTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-820s21c1
Sequence:CCGGGTTCGGAAGATGCCAGAAACTCTCGAGAGTTTCTGGCATCTTCCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-1033s21c1
Sequence:CCGGCTATTTGTTCCTAGGTGTAAACTCGAGTTTACACCTAGGAACAAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-662s21c1
Sequence:CCGGCCATTTCAGGATTTGGTCTCTCTCGAGAGAGACCAAATCCTGAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-354s21c1
Sequence:CCGGTGCAGAGAGCGCAGCATATTTCTCGAGAAATATGCTGCGCTCTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030571
VALIDATED
NDFIP1 MISSION shRNA Lentiviral Transduction Particles
Nedd4 family interacting protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030571.2-662s1c1
Sequence:CCGGCCATTTCAGGATTTGGTCTCTCTCGAGAGAGACCAAATCCTGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030571.2-2067s1c1
Sequence:CCGGGCACAAGAAGTCCTCTTATATCTCGAGATATAAGAGGACTTCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_030571.2-831s1c1
Sequence:CCGGGCCAGAAACTTTCTCAAATCTCTCGAGAGATTTGAGAAAGTTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030571.2-820s1c1
Sequence:CCGGGTTCGGAAGATGCCAGAAACTCTCGAGAGTTTCTGGCATCTTCCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030571.2-1949s1c1
Sequence:CCGGGCTTAATTTCTTGGCTTGCATCTCGAGATGCAAGCCAAGAAATTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030571.2-668s1c1
Sequence:CCGGCAGGATTTGGTCTCTCTCTAACTCGAGTTAGAGAGAGACCAAATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030571.2-469s1c1
Sequence:CCGGGAAGCTACTATCCCTTTGGTTCTCGAGAACCAAAGGGATAGTAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-831s21c1
Sequence:CCGGGCCAGAAACTTTCTCAAATCTCTCGAGAGATTTGAGAAAGTTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-820s21c1
Sequence:CCGGGTTCGGAAGATGCCAGAAACTCTCGAGAGTTTCTGGCATCTTCCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-1033s21c1
Sequence:CCGGCTATTTGTTCCTAGGTGTAAACTCGAGTTTACACCTAGGAACAAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-662s21c1
Sequence:CCGGCCATTTCAGGATTTGGTCTCTCTCGAGAGAGACCAAATCCTGAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030571.3-354s21c1
Sequence:CCGGTGCAGAGAGCGCAGCATATTTCTCGAGAAATATGCTGCGCTCTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022996
VALIDATED
NDFIP1 MISSION shRNA Bacterial Glycerol Stock
Nedd4 family interacting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-348s21c1
Sequence:CCGGCTACAACACTGCCCAGTTATGCTCGAGCATAACTGGGCAGTGTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-642s21c1
Sequence:CCGGCCTATTTCCCTGGATACTTTGCTCGAGCAAAGTATCCAGGGAAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-823s21c1
Sequence:CCGGGGCTTCCTGCACTGATGAAGTCTCGAGACTTCATCAGTGCAGGAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-709s21c1
Sequence:CCGGCCTGTTTCTCAGAGGATTTATCTCGAGATAAATCCTCTGAGAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-607s21c1
Sequence:CCGGTCTAATTAAGTGGATCCTTATCTCGAGATAAGGATCCACTTAATTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022996
VALIDATED
NDFIP1 MISSION shRNA shRNA Plasmid DNA
Nedd4 family interacting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-348s21c1
Sequence:CCGGCTACAACACTGCCCAGTTATGCTCGAGCATAACTGGGCAGTGTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-642s21c1
Sequence:CCGGCCTATTTCCCTGGATACTTTGCTCGAGCAAAGTATCCAGGGAAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-823s21c1
Sequence:CCGGGGCTTCCTGCACTGATGAAGTCTCGAGACTTCATCAGTGCAGGAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-709s21c1
Sequence:CCGGCCTGTTTCTCAGAGGATTTATCTCGAGATAAATCCTCTGAGAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-607s21c1
Sequence:CCGGTCTAATTAAGTGGATCCTTATCTCGAGATAAGGATCCACTTAATTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022996
VALIDATED
NDFIP1 MISSION shRNA Lentiviral Transduction Particles
Nedd4 family interacting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-348s21c1
Sequence:CCGGCTACAACACTGCCCAGTTATGCTCGAGCATAACTGGGCAGTGTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-642s21c1
Sequence:CCGGCCTATTTCCCTGGATACTTTGCTCGAGCAAAGTATCCAGGGAAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-823s21c1
Sequence:CCGGGGCTTCCTGCACTGATGAAGTCTCGAGACTTCATCAGTGCAGGAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-709s21c1
Sequence:CCGGCCTGTTTCTCAGAGGATTTATCTCGAGATAAATCCTCTGAGAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022996.1-607s21c1
Sequence:CCGGTCTAATTAAGTGGATCCTTATCTCGAGATAAGGATCCACTTAATTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)