EMAIL THIS PAGE TO A FRIEND

NDFIP2

Nedd4 family interacting protein 2

117 Gene Product Result for
Synonyms: N4WBP5A
UniProtKB ID: Q9NV92, Q7Z2H3, Q7Z428, Q8TAR3, Q9ULQ5
Gene ID:
Mouse(76273) Nedd4 family interacting protein 2
Rat(361089) Nedd4 family interacting protein 2
Zebrafish(406656) Nedd4 family interacting protein 2
dog(476956) Nedd4 family interacting protein 2
cow(512310) Nedd4 family interacting protein 2
domestic cat(101090228) Nedd4 family interacting protein 2
chicken(418803) Nedd4 family interacting protein 2
sheep(101104583) Nedd4 family interacting protein 2
naked mole-rat(101707324) Nedd4 family interacting protein 2
domestic guinea pig(100724605) Nedd4 family interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019080 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019080 Rosetta Predictions human pricing
NM_001108390 Rosetta Predictions rat pricing
NM_029561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031994 predicted 397
2 SASI_Hs02_00352678 predicted 371
3 SASI_Hs01_00031995 predicted 905
4 SASI_Hs01_00031996 predicted 512
5 SASI_Hs01_00031998 predicted 491
6 SASI_Hs01_00032000 predicted 1059
7 SASI_Hs01_00032001 predicted 919
8 SASI_Hs02_00352679 predicted 977
9 SASI_Hs01_00032002 predicted 389
10 SASI_Hs01_00032003 predicted 578
11 SASI_Hs01_00031997 predicted 985
12 SASI_Hs01_00031999 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238189 predicted 575
2 SASI_Rn02_00238190 predicted 1057
3 SASI_Rn02_00238191 predicted 717
4 SASI_Rn02_00238192 predicted 267
5 SASI_Rn02_00238193 predicted 1021
6 SASI_Rn02_00238194 predicted 1059
7 SASI_Rn02_00238195 predicted 970
8 SASI_Rn02_00238196 predicted 913
9 SASI_Rn02_00238197 predicted 842
10 SASI_Rn02_00238198 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147273 predicted 208
2 SASI_Mm01_00147274 predicted 728
3 SASI_Mm01_00147275 predicted 748
4 SASI_Mm01_00147276 predicted 949
5 SASI_Mm01_00147277 predicted 200
6 SASI_Mm01_00147278 predicted 769
7 SASI_Mm01_00147279 predicted 861
8 SASI_Mm01_00147280 predicted 660
9 SASI_Mm01_00147281 predicted 930
10 SASI_Mm02_00335510 predicted 674
11 SASI_Mm01_00147272 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019080
VALIDATED
NDFIP2 MISSION shRNA Bacterial Glycerol Stock
Nedd4 family interacting protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-421s21c1
Sequence:CCGGACTCAGAATCATCGGCTATAGCTCGAGCTATAGCCGATGATTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019080.1-1509s1c1
Sequence:CCGGGCAGTTCTACACATGAAACATCTCGAGATGTTTCATGTGTAGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019080.1-804s1c1
Sequence:CCGGCCTTCTGTATCACCAATACCACTCGAGTGGTATTGGTGATACAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019080.1-622s1c1
Sequence:CCGGGAAGGCTAAAGCTGCTGCAATCTCGAGATTGCAGCAGCTTTAGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-957s21c1
Sequence:CCGGTATTGGCTTTGGTGGATATTTCTCGAGAAATATCCACCAAAGCCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-883s21c1
Sequence:CCGGTTGGCCTTTCCTTGATCAAATCTCGAGATTTGATCAAGGAAAGGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-389s21c1
Sequence:CCGGGCGCTACCAGGTGCTTCTTAACTCGAGTTAAGAAGCACCTGGTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019080.1-1332s1c1
Sequence:CCGGGCAGTTAAGTCCAGTCACATTCTCGAGAATGTGACTGGACTTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019080.1-1028s1c1
Sequence:CCGGGCTGCTCATAGAACAAGGTATCTCGAGATACCTTGTTCTATGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-618s21c1
Sequence:CCGGGCTACCTCTCTTCCTACATACCTCGAGGTATGTAGGAAGAGAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019080.2-524s21c1
Sequence:CCGGTCCACCATATAGTAGTATTACCTCGAGGTAATACTACTATATGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019080
VALIDATED
NDFIP2 MISSION shRNA shRNA Plasmid DNA
Nedd4 family interacting protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-421s21c1
Sequence:CCGGACTCAGAATCATCGGCTATAGCTCGAGCTATAGCCGATGATTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019080.1-1509s1c1
Sequence:CCGGGCAGTTCTACACATGAAACATCTCGAGATGTTTCATGTGTAGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019080.1-804s1c1
Sequence:CCGGCCTTCTGTATCACCAATACCACTCGAGTGGTATTGGTGATACAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019080.1-622s1c1
Sequence:CCGGGAAGGCTAAAGCTGCTGCAATCTCGAGATTGCAGCAGCTTTAGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-957s21c1
Sequence:CCGGTATTGGCTTTGGTGGATATTTCTCGAGAAATATCCACCAAAGCCAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-883s21c1
Sequence:CCGGTTGGCCTTTCCTTGATCAAATCTCGAGATTTGATCAAGGAAAGGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-389s21c1
Sequence:CCGGGCGCTACCAGGTGCTTCTTAACTCGAGTTAAGAAGCACCTGGTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019080.1-1332s1c1
Sequence:CCGGGCAGTTAAGTCCAGTCACATTCTCGAGAATGTGACTGGACTTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019080.1-1028s1c1
Sequence:CCGGGCTGCTCATAGAACAAGGTATCTCGAGATACCTTGTTCTATGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-618s21c1
Sequence:CCGGGCTACCTCTCTTCCTACATACCTCGAGGTATGTAGGAAGAGAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019080.2-524s21c1
Sequence:CCGGTCCACCATATAGTAGTATTACCTCGAGGTAATACTACTATATGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019080
VALIDATED
NDFIP2 MISSION shRNA Lentiviral Transduction Particles
Nedd4 family interacting protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-421s21c1
Sequence:CCGGACTCAGAATCATCGGCTATAGCTCGAGCTATAGCCGATGATTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019080.1-1509s1c1
Sequence:CCGGGCAGTTCTACACATGAAACATCTCGAGATGTTTCATGTGTAGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019080.1-804s1c1
Sequence:CCGGCCTTCTGTATCACCAATACCACTCGAGTGGTATTGGTGATACAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019080.1-622s1c1
Sequence:CCGGGAAGGCTAAAGCTGCTGCAATCTCGAGATTGCAGCAGCTTTAGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-957s21c1
Sequence:CCGGTATTGGCTTTGGTGGATATTTCTCGAGAAATATCCACCAAAGCCAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-883s21c1
Sequence:CCGGTTGGCCTTTCCTTGATCAAATCTCGAGATTTGATCAAGGAAAGGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-389s21c1
Sequence:CCGGGCGCTACCAGGTGCTTCTTAACTCGAGTTAAGAAGCACCTGGTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019080.1-1332s1c1
Sequence:CCGGGCAGTTAAGTCCAGTCACATTCTCGAGAATGTGACTGGACTTAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019080.1-1028s1c1
Sequence:CCGGGCTGCTCATAGAACAAGGTATCTCGAGATACCTTGTTCTATGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019080.2-618s21c1
Sequence:CCGGGCTACCTCTCTTCCTACATACCTCGAGGTATGTAGGAAGAGAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019080.2-524s21c1
Sequence:CCGGTCCACCATATAGTAGTATTACCTCGAGGTAATACTACTATATGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029561
VALIDATED
NDFIP2 MISSION shRNA Bacterial Glycerol Stock
Nedd4 family interacting protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-759s1c1
Sequence:CCGGCTTTGGTGGATATTTCTCGTACTCGAGTACGAGAAATATCCACCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029561.1-1257s1c1
Sequence:CCGGGCGTAATCAGAGTTACACTATCTCGAGATAGTGTAACTCTGATTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-594s1c1
Sequence:CCGGGCATTCATATTCAACTGGCTTCTCGAGAAGCCAGTTGAATATGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-1320s21c1
Sequence:CCGGAGTAATCCACACACGAAATATCTCGAGATATTTCGTGTGTGGATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-865s21c1
Sequence:CCGGGAGGTACTTCTTCCTGCTATACTCGAGTATAGCAGGAAGAAGTACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-758s21c1
Sequence:CCGGCTTTGGTGGATATTTCTCGTACTCGAGTACGAGAAATATCCACCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-413s21c1
Sequence:CCGGGCTACCTCTCTGCCTACATATCTCGAGATATGTAGGCAGAGAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-355s1c1
Sequence:CCGGCCACTTCAGATACTGACGTGTCTCGAGACACGTCAGTATCTGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-354s21c1
Sequence:CCGGCCACTTCAGATACTGACGTGTCTCGAGACACGTCAGTATCTGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-866s1c1
Sequence:CCGGGAGGTACTTCTTCCTGCTATACTCGAGTATAGCAGGAAGAAGTACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029561
VALIDATED
NDFIP2 MISSION shRNA shRNA Plasmid DNA
Nedd4 family interacting protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-759s1c1
Sequence:CCGGCTTTGGTGGATATTTCTCGTACTCGAGTACGAGAAATATCCACCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029561.1-1257s1c1
Sequence:CCGGGCGTAATCAGAGTTACACTATCTCGAGATAGTGTAACTCTGATTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-594s1c1
Sequence:CCGGGCATTCATATTCAACTGGCTTCTCGAGAAGCCAGTTGAATATGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-1320s21c1
Sequence:CCGGAGTAATCCACACACGAAATATCTCGAGATATTTCGTGTGTGGATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-865s21c1
Sequence:CCGGGAGGTACTTCTTCCTGCTATACTCGAGTATAGCAGGAAGAAGTACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-758s21c1
Sequence:CCGGCTTTGGTGGATATTTCTCGTACTCGAGTACGAGAAATATCCACCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-413s21c1
Sequence:CCGGGCTACCTCTCTGCCTACATATCTCGAGATATGTAGGCAGAGAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-355s1c1
Sequence:CCGGCCACTTCAGATACTGACGTGTCTCGAGACACGTCAGTATCTGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-354s21c1
Sequence:CCGGCCACTTCAGATACTGACGTGTCTCGAGACACGTCAGTATCTGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-866s1c1
Sequence:CCGGGAGGTACTTCTTCCTGCTATACTCGAGTATAGCAGGAAGAAGTACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029561
VALIDATED
NDFIP2 MISSION shRNA Lentiviral Transduction Particles
Nedd4 family interacting protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-759s1c1
Sequence:CCGGCTTTGGTGGATATTTCTCGTACTCGAGTACGAGAAATATCCACCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029561.1-1257s1c1
Sequence:CCGGGCGTAATCAGAGTTACACTATCTCGAGATAGTGTAACTCTGATTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-594s1c1
Sequence:CCGGGCATTCATATTCAACTGGCTTCTCGAGAAGCCAGTTGAATATGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-1320s21c1
Sequence:CCGGAGTAATCCACACACGAAATATCTCGAGATATTTCGTGTGTGGATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-865s21c1
Sequence:CCGGGAGGTACTTCTTCCTGCTATACTCGAGTATAGCAGGAAGAAGTACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-758s21c1
Sequence:CCGGCTTTGGTGGATATTTCTCGTACTCGAGTACGAGAAATATCCACCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-413s21c1
Sequence:CCGGGCTACCTCTCTGCCTACATATCTCGAGATATGTAGGCAGAGAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-355s1c1
Sequence:CCGGCCACTTCAGATACTGACGTGTCTCGAGACACGTCAGTATCTGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029561.3-354s21c1
Sequence:CCGGCCACTTCAGATACTGACGTGTCTCGAGACACGTCAGTATCTGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029561.1-866s1c1
Sequence:CCGGGAGGTACTTCTTCCTGCTATACTCGAGTATAGCAGGAAGAAGTACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)