EMAIL THIS PAGE TO A FRIEND

NDN

necdin, melanoma antigen (MAGE) family member

114 Gene Product Result for
Synonyms: HsT16328 PWCR
UniProtKB ID: Q99608, B2R6Z5
Gene ID:
Human(4692) Summary: This intronless gene is located in the Prader-Willi syndrome deletion region. It is an imprinted gene and is expressed exclusively from the paternal allele. Studies in mouse suggest that the protein encoded by this gene may suppress growth in postmitotic neurons. [provided by RefSeq, Jul 2008]
Mouse(17984) necdin
Rat(308690) necdin, melanoma antigen (MAGE) family member
dog(488693) necdin homolog (mouse)
domestic cat(101088934) necdin homolog (mouse)
cow(386664) necdin homolog (mouse)
sheep(101113535) necdin homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100150 Anti-NDN (281-295) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2104399 Anti-NDN antibody produced in rabbit affinity isolated antibody bovine, goat, pig, human, horse, rat, mouse, rabbit, guinea pig, sheep, canine
western blot pricing
SAB1410824 Anti-NDN antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA074457 Anti-NDN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0004692M2 Monoclonal Anti-NDN antibody produced in mouse clone 1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1409342 Monoclonal Anti-NDN antibody produced in mouse clone 3B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1409343 Monoclonal Anti-NDN antibody produced in mouse clone 3C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1409344 Monoclonal Anti-NDN antibody produced in mouse clone 2G8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP) pricing
SAB1404111 Monoclonal Anti-NDN, (C-terminal) antibody produced in mouse clone 2D11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002487 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013751 MISSION® esiRNA esiRNA targeting human NDN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002487 Rosetta Predictions human pricing
NM_001008558 Rosetta Predictions rat pricing
NM_010882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123319 predicted 1246
2 SASI_Hs01_00123320 predicted 1334
3 SASI_Hs01_00123321 predicted 1228
4 SASI_Hs01_00123322 predicted 882
5 SASI_Hs01_00123323 predicted 798
6 SASI_Hs01_00123324 predicted 883
7 SASI_Hs01_00123325 predicted 1311
8 SASI_Hs01_00123326 predicted 1040
9 SASI_Hs01_00123327 predicted 441
10 SASI_Hs01_00123328 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040227 predicted 1361
2 SASI_Rn01_00040228 predicted 1307
3 SASI_Rn01_00040229 predicted 1334
4 SASI_Rn01_00040230 predicted 751
5 SASI_Rn01_00040231 predicted 1113
6 SASI_Rn01_00040233 predicted 1199
7 SASI_Rn01_00040234 predicted 1190
8 SASI_Rn01_00040235 predicted 1101
9 SASI_Rn02_00199236 predicted 1364
10 SASI_Rn02_00199237 predicted 1252
11 SASI_Rn01_00040232 predicted 775
12 SASI_Rn01_00040236 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319577 predicted 1168
2 SASI_Mm01_00121271 predicted 1118
3 SASI_Mm01_00121272 predicted 1288
4 SASI_Mm02_00319578 predicted 832
5 SASI_Mm01_00121274 predicted 503
6 SASI_Mm01_00121276 predicted 1382
7 SASI_Mm01_00121277 predicted 946
8 SASI_Mm01_00121278 predicted 1263
9 SASI_Mm01_00121279 predicted 1246
10 SASI_Mm01_00121280 predicted 631
11 SASI_Mm01_00121273 predicted 1232
12 SASI_Mm01_00121275 predicted 1124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010882
VALIDATED
NDN MISSION shRNA Bacterial Glycerol Stock
necdin, melanoma antigen (MAGE) family member
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-761s1c1
Sequence:CCGGCGGAGACGTGAGGAAGATAATCTCGAGATTATCTTCCTCACGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-915s1c1
Sequence:CCGGGCCAGAGTCTTCAAGAAAGATCTCGAGATCTTTCTTGAAGACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-1295s1c1
Sequence:CCGGGCTGTGCTAAACTTGTGAAATCTCGAGATTTCACAAGTTTAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-659s1c1
Sequence:CCGGCCTGAGCCTCATCTATGTGAACTCGAGTTCACATAGATGAGGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010882.2-249s1c1
Sequence:CCGGCCCGAAGAACGGATAGAAGATCTCGAGATCTTCTATCCGTTCTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-981s21c1
Sequence:CCGGGCCAGAGTCTTCAAGAAAGATCTCGAGATCTTTCTTGAAGACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-725s21c1
Sequence:CCGGCCTGAGCCTCATCTATGTGAACTCGAGTTCACATAGATGAGGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-1361s21c1
Sequence:CCGGGCTGTGCTAAACTTGTGAAATCTCGAGATTTCACAAGTTTAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-827s21c1
Sequence:CCGGCGGAGACGTGAGGAAGATAATCTCGAGATTATCTTCCTCACGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-932s21c1
Sequence:CCGGGTCCAGAGCTAACCGTGAAATCTCGAGATTTCACGGTTAGCTCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010882
VALIDATED
NDN MISSION shRNA shRNA Plasmid DNA
necdin, melanoma antigen (MAGE) family member
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-761s1c1
Sequence:CCGGCGGAGACGTGAGGAAGATAATCTCGAGATTATCTTCCTCACGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-915s1c1
Sequence:CCGGGCCAGAGTCTTCAAGAAAGATCTCGAGATCTTTCTTGAAGACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-1295s1c1
Sequence:CCGGGCTGTGCTAAACTTGTGAAATCTCGAGATTTCACAAGTTTAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-659s1c1
Sequence:CCGGCCTGAGCCTCATCTATGTGAACTCGAGTTCACATAGATGAGGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010882.2-249s1c1
Sequence:CCGGCCCGAAGAACGGATAGAAGATCTCGAGATCTTCTATCCGTTCTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-981s21c1
Sequence:CCGGGCCAGAGTCTTCAAGAAAGATCTCGAGATCTTTCTTGAAGACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-725s21c1
Sequence:CCGGCCTGAGCCTCATCTATGTGAACTCGAGTTCACATAGATGAGGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-1361s21c1
Sequence:CCGGGCTGTGCTAAACTTGTGAAATCTCGAGATTTCACAAGTTTAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-827s21c1
Sequence:CCGGCGGAGACGTGAGGAAGATAATCTCGAGATTATCTTCCTCACGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-932s21c1
Sequence:CCGGGTCCAGAGCTAACCGTGAAATCTCGAGATTTCACGGTTAGCTCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010882
VALIDATED
NDN MISSION shRNA Lentiviral Transduction Particles
necdin, melanoma antigen (MAGE) family member
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-761s1c1
Sequence:CCGGCGGAGACGTGAGGAAGATAATCTCGAGATTATCTTCCTCACGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-915s1c1
Sequence:CCGGGCCAGAGTCTTCAAGAAAGATCTCGAGATCTTTCTTGAAGACTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-1295s1c1
Sequence:CCGGGCTGTGCTAAACTTGTGAAATCTCGAGATTTCACAAGTTTAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010882.2-659s1c1
Sequence:CCGGCCTGAGCCTCATCTATGTGAACTCGAGTTCACATAGATGAGGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010882.2-249s1c1
Sequence:CCGGCCCGAAGAACGGATAGAAGATCTCGAGATCTTCTATCCGTTCTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-981s21c1
Sequence:CCGGGCCAGAGTCTTCAAGAAAGATCTCGAGATCTTTCTTGAAGACTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-725s21c1
Sequence:CCGGCCTGAGCCTCATCTATGTGAACTCGAGTTCACATAGATGAGGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-1361s21c1
Sequence:CCGGGCTGTGCTAAACTTGTGAAATCTCGAGATTTCACAAGTTTAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-827s21c1
Sequence:CCGGCGGAGACGTGAGGAAGATAATCTCGAGATTATCTTCCTCACGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010882.3-932s21c1
Sequence:CCGGGTCCAGAGCTAACCGTGAAATCTCGAGATTTCACGGTTAGCTCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002487
NDN MISSION shRNA Bacterial Glycerol Stock
necdin, melanoma antigen (MAGE) family member
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-890s1c1
Sequence:CCGGCGAAATCACCAAGATGCAAATCTCGAGATTTGCATCTTGGTGATTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-113s1c1
Sequence:CCGGCGACCCTAACTTTGCAGCCGACTCGAGTCGGCTGCAAAGTTAGGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-806s1c1
Sequence:CCGGCCAAATGAATTACCTGAAGTACTCGAGTACTTCAGGTAATTCATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-668s1c1
Sequence:CCGGCCTGAGCCTCATCTACGTGAACTCGAGTTCACGTAGATGAGGCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-461s1c1
Sequence:CCGGGAAAGATGTCATCGGCAGCTACTCGAGTAGCTGCCGATGACATCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002487
NDN MISSION shRNA shRNA Plasmid DNA
necdin, melanoma antigen (MAGE) family member
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-890s1c1
Sequence:CCGGCGAAATCACCAAGATGCAAATCTCGAGATTTGCATCTTGGTGATTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-113s1c1
Sequence:CCGGCGACCCTAACTTTGCAGCCGACTCGAGTCGGCTGCAAAGTTAGGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-806s1c1
Sequence:CCGGCCAAATGAATTACCTGAAGTACTCGAGTACTTCAGGTAATTCATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-668s1c1
Sequence:CCGGCCTGAGCCTCATCTACGTGAACTCGAGTTCACGTAGATGAGGCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-461s1c1
Sequence:CCGGGAAAGATGTCATCGGCAGCTACTCGAGTAGCTGCCGATGACATCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002487
NDN MISSION shRNA Lentiviral Transduction Particles
necdin, melanoma antigen (MAGE) family member
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-890s1c1
Sequence:CCGGCGAAATCACCAAGATGCAAATCTCGAGATTTGCATCTTGGTGATTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-113s1c1
Sequence:CCGGCGACCCTAACTTTGCAGCCGACTCGAGTCGGCTGCAAAGTTAGGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-806s1c1
Sequence:CCGGCCAAATGAATTACCTGAAGTACTCGAGTACTTCAGGTAATTCATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-668s1c1
Sequence:CCGGCCTGAGCCTCATCTACGTGAACTCGAGTTCACGTAGATGAGGCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002487.2-461s1c1
Sequence:CCGGGAAAGATGTCATCGGCAGCTACTCGAGTAGCTGCCGATGACATCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)