EMAIL THIS PAGE TO A FRIEND

NDP

Norrie disease (pseudoglioma)

117 Gene Product Result for
Synonyms: EVR2 FEVR ND
UniProtKB ID: Q00604, B2R8K6, Q5JYH5
Gene ID:
Human(4693) Summary: This gene encodes a secreted protein with a cystein-knot motif that activates the Wnt/beta-catenin pathway. The protein forms disulfide-linked oligomers in the extracellular matrix. Mutations in this gene result in Norrie disease and X-linked exudative vitreoretinopathy. [provided by RefSeq, Feb 2009]
Mouse(17986) Norrie disease (pseudoglioma) (human)
Rat(363443) Norrie disease (pseudoglioma)
chicken(418560) Norrie disease (pseudoglioma)
dog(612440) Norrie disease (pseudoglioma)
cow(511596) Norrie disease (pseudoglioma)
domestic cat(101092497) Norrie disease (pseudoglioma)
naked mole-rat(101723959) Norrie disease (pseudoglioma)
domestic guinea pig(100731010) Norrie disease (pseudoglioma)
sheep(101106910) Norrie disease (pseudoglioma)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1602 Human Norrin ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000266 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057121 MISSION® esiRNA esiRNA human NDP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000266 Rosetta Predictions human pricing
NM_001108814 Rosetta Predictions rat pricing
NM_010883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106529 predicted 725
2 SASI_Hs01_00106530 predicted 642
3 SASI_Hs01_00106531 predicted 1066
4 SASI_Hs01_00106532 predicted 1017
5 SASI_Hs01_00106533 predicted 1060
6 SASI_Hs01_00106534 predicted 1101
7 SASI_Hs01_00106535 predicted 1015
8 SASI_Hs01_00106536 predicted 636
9 SASI_Hs01_00106537 predicted 1041
10 SASI_Hs02_00302217 predicted 632
11 SASI_Hs01_00106528 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242335 predicted 571
2 SASI_Rn02_00242336 predicted 1211
3 SASI_Rn02_00242337 predicted 1414
4 SASI_Rn02_00242338 predicted 845
5 SASI_Rn02_00242339 predicted 1286
6 SASI_Rn02_00242340 predicted 1413
7 SASI_Rn02_00242341 predicted 687
8 SASI_Rn02_00242342 predicted 671
9 SASI_Rn02_00242343 predicted 691
10 SASI_Rn02_00242344 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175011 predicted 1344
2 SASI_Mm01_00175012 predicted 593
3 SASI_Mm01_00175013 predicted 1078
4 SASI_Mm01_00175014 predicted 960
5 SASI_Mm01_00175016 predicted 678
6 SASI_Mm01_00175017 predicted 877
7 SASI_Mm01_00175018 predicted 1353
8 SASI_Mm01_00175019 predicted 1436
9 SASI_Mm01_00175020 predicted 1112
10 SASI_Mm02_00319579 predicted 691
11 SASI_Mm01_00175015 predicted 1307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000266
NDP MISSION shRNA Bacterial Glycerol Stock
Norrie disease (pseudoglioma)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-531s1c1
Sequence:CCGGGCACCACTATGTGGATTCTATCTCGAGATAGAATCCACATAGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-554s1c1
Sequence:CCGGGTCACCCATTGTACAAGTGTACTCGAGTACACTTGTACAATGGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-452s1c1
Sequence:CCGGTGCTGGTGATAATGGGAGATACTCGAGTATCTCCCATTATCACCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-747s1c1
Sequence:CCGGCATGCGACTCACTGCCACCTACTCGAGTAGGTGGCAGTGAGTCGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-570s1c1
Sequence:CCGGGTGTAGCTCAAAGATGGTGCTCTCGAGAGCACCATCTTTGAGCTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000266.3-655s21c1
Sequence:CCGGACGGACAGCTCATTCATAATGCTCGAGCATTATGAATGAGCTGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000266.3-1099s21c1
Sequence:CCGGCTCTGCATATTCTAGTAATAACTCGAGTTATTACTAGAATATGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000266.3-1447s21c1
Sequence:CCGGCTGCTAAAGGTTACCGATTTCCTCGAGGAAATCGGTAACCTTTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000266
NDP MISSION shRNA shRNA Plasmid DNA
Norrie disease (pseudoglioma)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-531s1c1
Sequence:CCGGGCACCACTATGTGGATTCTATCTCGAGATAGAATCCACATAGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-554s1c1
Sequence:CCGGGTCACCCATTGTACAAGTGTACTCGAGTACACTTGTACAATGGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-452s1c1
Sequence:CCGGTGCTGGTGATAATGGGAGATACTCGAGTATCTCCCATTATCACCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-747s1c1
Sequence:CCGGCATGCGACTCACTGCCACCTACTCGAGTAGGTGGCAGTGAGTCGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-570s1c1
Sequence:CCGGGTGTAGCTCAAAGATGGTGCTCTCGAGAGCACCATCTTTGAGCTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000266.3-655s21c1
Sequence:CCGGACGGACAGCTCATTCATAATGCTCGAGCATTATGAATGAGCTGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000266.3-1099s21c1
Sequence:CCGGCTCTGCATATTCTAGTAATAACTCGAGTTATTACTAGAATATGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000266.3-1447s21c1
Sequence:CCGGCTGCTAAAGGTTACCGATTTCCTCGAGGAAATCGGTAACCTTTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000266
NDP MISSION shRNA Lentiviral Transduction Particles
Norrie disease (pseudoglioma)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-531s1c1
Sequence:CCGGGCACCACTATGTGGATTCTATCTCGAGATAGAATCCACATAGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-554s1c1
Sequence:CCGGGTCACCCATTGTACAAGTGTACTCGAGTACACTTGTACAATGGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-452s1c1
Sequence:CCGGTGCTGGTGATAATGGGAGATACTCGAGTATCTCCCATTATCACCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-747s1c1
Sequence:CCGGCATGCGACTCACTGCCACCTACTCGAGTAGGTGGCAGTGAGTCGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000266.1-570s1c1
Sequence:CCGGGTGTAGCTCAAAGATGGTGCTCTCGAGAGCACCATCTTTGAGCTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000266.3-655s21c1
Sequence:CCGGACGGACAGCTCATTCATAATGCTCGAGCATTATGAATGAGCTGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000266.3-1099s21c1
Sequence:CCGGCTCTGCATATTCTAGTAATAACTCGAGTTATTACTAGAATATGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000266.3-1447s21c1
Sequence:CCGGCTGCTAAAGGTTACCGATTTCCTCGAGGAAATCGGTAACCTTTAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010883
NDP MISSION shRNA Bacterial Glycerol Stock
Norrie disease (pseudoglioma)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010883.2-1408s1c1
Sequence:CCGGGCCTCTAAAGTTTCCTGGTTTCTCGAGAAACCAGGAAACTTTAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-701s1c1
Sequence:CCGGGACACCATTATGTCGATTCTACTCGAGTAGAATCGACATAATGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-735s1c1
Sequence:CCGGGTACAAATGTAGCTCAAAGATCTCGAGATCTTTGAGCTACATTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-918s1c1
Sequence:CCGGCATGCGACTTACTGCCACTTACTCGAGTAAGTGGCAGTAAGTCGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-714s1c1
Sequence:CCGGCGATTCTATCAGTCACCCACTCTCGAGAGTGGGTGACTGATAGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010883
NDP MISSION shRNA shRNA Plasmid DNA
Norrie disease (pseudoglioma)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010883.2-1408s1c1
Sequence:CCGGGCCTCTAAAGTTTCCTGGTTTCTCGAGAAACCAGGAAACTTTAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-701s1c1
Sequence:CCGGGACACCATTATGTCGATTCTACTCGAGTAGAATCGACATAATGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-735s1c1
Sequence:CCGGGTACAAATGTAGCTCAAAGATCTCGAGATCTTTGAGCTACATTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-918s1c1
Sequence:CCGGCATGCGACTTACTGCCACTTACTCGAGTAAGTGGCAGTAAGTCGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-714s1c1
Sequence:CCGGCGATTCTATCAGTCACCCACTCTCGAGAGTGGGTGACTGATAGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010883
NDP MISSION shRNA Lentiviral Transduction Particles
Norrie disease (pseudoglioma)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010883.2-1408s1c1
Sequence:CCGGGCCTCTAAAGTTTCCTGGTTTCTCGAGAAACCAGGAAACTTTAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-701s1c1
Sequence:CCGGGACACCATTATGTCGATTCTACTCGAGTAGAATCGACATAATGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-735s1c1
Sequence:CCGGGTACAAATGTAGCTCAAAGATCTCGAGATCTTTGAGCTACATTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-918s1c1
Sequence:CCGGCATGCGACTTACTGCCACTTACTCGAGTAAGTGGCAGTAAGTCGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010883.2-714s1c1
Sequence:CCGGCGATTCTATCAGTCACCCACTCTCGAGAGTGGGTGACTGATAGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)