EMAIL THIS PAGE TO A FRIEND

NDRG1

N-myc downstream regulated 1

89 Gene Product Result for
Synonyms: CAP43 CMT4D DRG-1 DRG1 GC4 HMSNL NDR1 NMSL PROXY1 RIT42 RTP TARG1 TDD5
Gene ID:
Human(10397) Summary: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(17988) N-myc downstream regulated gene 1
Rat(299923) N-myc downstream regulated 1
chicken(420321) N-myc downstream regulated 1
cow(504499) N-myc downstream regulated 1
domestic cat(101089078) N-myc downstream regulated 1
Horse(100068997) N-myc downstream regulated 1
dog(482049) N-myc downstream regulated 1
sheep(101120172) N-myc downstream regulated 1
domestic guinea pig(100728790) N-myc downstream regulated 1
naked mole-rat(101722001) N-myc downstream regulated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006096 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_010884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006096 siRNAs that have been validated in the lab human pricing
NM_001011991 Rosetta Predictions rat pricing
XM_576281 Rosetta Predictions rat pricing
NM_008681 Rosetta Predictions mouse pricing
NM_010884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006096 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034470 validated 559
2 SASI_Hs01_00034471 predicted 1415
3 SASI_Hs01_00034472 predicted 1072
4 SASI_Hs01_00034473 predicted 1414
5 SASI_Hs01_00034474 predicted 1423
6 SASI_Hs01_00034475 predicted 564
7 SASI_Hs01_00034477 predicted 591
8 SASI_Hs01_00034478 predicted 250
9 SASI_Hs01_00034479 predicted 967
10 SASI_Hs02_00340879 predicted 1417
11 SASI_Hs01_00034476 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032761 predicted 701
2 SASI_Rn01_00032762 predicted 479
3 SASI_Rn01_00032763 predicted 1389
4 SASI_Rn01_00032764 predicted 376
5 SASI_Rn01_00032765 predicted 348
6 SASI_Rn01_00032766 predicted 563
7 SASI_Rn01_00032767 predicted 311
8 SASI_Rn01_00032769 predicted 516
9 SASI_Rn01_00032770 predicted 620
10 SASI_Rn02_00200023 predicted 984
11 SASI_Rn01_00032768 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576281 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178143 predicted 484
2 SASI_Rn01_00178144 predicted 1395
3 SASI_Rn01_00178145 predicted 384
4 SASI_Rn01_00178146 predicted 354
5 SASI_Rn01_00178147 predicted 327
6 SASI_Rn01_00178148 predicted 1285
7 SASI_Rn01_00178149 predicted 1754
8 SASI_Rn01_00178150 predicted 1522
9 SASI_Rn01_00178151 predicted 1566
10 SASI_Rn01_00178152 predicted 1761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314463 predicted 489
2 SASI_Mm02_00314464 predicted 1610
3 SASI_Mm01_00121884 predicted 1408
4 SASI_Mm01_00121887 predicted 336
5 SASI_Mm01_00121888 predicted 1601
6 SASI_Mm02_00314465 predicted 1520
7 SASI_Mm02_00314466 predicted 317
8 SASI_Mm02_00314467 predicted 579
9 SASI_Mm02_00314468 predicted 1293
10 SASI_Mm02_00314469 predicted 1518
11 SASI_Mm01_00121882 predicted 303
12 SASI_Mm01_00121883 predicted 1225
13 SASI_Mm01_00121885 predicted 1479
14 SASI_Mm01_00121886 predicted 1692
15 SASI_Mm01_00121889 predicted 932
16 SASI_Mm01_00121890 predicted 1465
17 SASI_Mm01_00121891 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123672 predicted 490
2 SASI_Mm01_00123673 predicted 722
3 SASI_Mm01_00123674 predicted 1615
4 SASI_Mm01_00123675 predicted 1412
5 SASI_Mm01_00123676 predicted 331
6 SASI_Mm01_00123677 predicted 1611
7 SASI_Mm01_00123678 predicted 1520
8 SASI_Mm01_00123679 predicted 320
9 SASI_Mm01_00123680 predicted 577
10 SASI_Mm01_00123681 predicted 1302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006096
VALIDATED
NDRG1 MISSION shRNA Bacterial Glycerol Stock
N-myc downstream regulated 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-556s21c1
Sequence:CCGGCCTGGAGTCCTTCAACAGTTTCTCGAGAAACTGTTGAAGGACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-828s21c1
Sequence:CCGGGCACATTGTGAATGACATGAACTCGAGTTCATGTCATTCACAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-2358s1c1
Sequence:CCGGCCAGCTTGGTTCCAGGAATTTCTCGAGAAATTCCTGGAACCAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-1461s21c1
Sequence:CCGGCTGCGCCTAACTCGGTATTAACTCGAGTTAATACCGAGTTAGGCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-616s21c1
Sequence:CCGGGCCTACATCCTAACTCGATTTCTCGAGAAATCGAGTTAGGATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-779s1c1
Sequence:CCGGGCACATTGTGAATGACATGAACTCGAGTTCATGTCATTCACAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-507s1c1
Sequence:CCGGCCTGGAGTCCTTCAACAGTTTCTCGAGAAACTGTTGAAGGACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-587s1c1
Sequence:CCGGTGCTCTAAACAACCCTGAGATCTCGAGATCTCAGGGTTGTTTAGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-567s1c1
Sequence:CCGGGCCTACATCCTAACTCGATTTCTCGAGAAATCGAGTTAGGATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006096
VALIDATED
NDRG1 MISSION shRNA shRNA Plasmid DNA
N-myc downstream regulated 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-556s21c1
Sequence:CCGGCCTGGAGTCCTTCAACAGTTTCTCGAGAAACTGTTGAAGGACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-828s21c1
Sequence:CCGGGCACATTGTGAATGACATGAACTCGAGTTCATGTCATTCACAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-2358s1c1
Sequence:CCGGCCAGCTTGGTTCCAGGAATTTCTCGAGAAATTCCTGGAACCAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-1461s21c1
Sequence:CCGGCTGCGCCTAACTCGGTATTAACTCGAGTTAATACCGAGTTAGGCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-616s21c1
Sequence:CCGGGCCTACATCCTAACTCGATTTCTCGAGAAATCGAGTTAGGATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-779s1c1
Sequence:CCGGGCACATTGTGAATGACATGAACTCGAGTTCATGTCATTCACAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-507s1c1
Sequence:CCGGCCTGGAGTCCTTCAACAGTTTCTCGAGAAACTGTTGAAGGACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-587s1c1
Sequence:CCGGTGCTCTAAACAACCCTGAGATCTCGAGATCTCAGGGTTGTTTAGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-567s1c1
Sequence:CCGGGCCTACATCCTAACTCGATTTCTCGAGAAATCGAGTTAGGATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006096
VALIDATED
NDRG1 MISSION shRNA Lentiviral Transduction Particles
N-myc downstream regulated 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-556s21c1
Sequence:CCGGCCTGGAGTCCTTCAACAGTTTCTCGAGAAACTGTTGAAGGACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-828s21c1
Sequence:CCGGGCACATTGTGAATGACATGAACTCGAGTTCATGTCATTCACAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-2358s1c1
Sequence:CCGGCCAGCTTGGTTCCAGGAATTTCTCGAGAAATTCCTGGAACCAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-1461s21c1
Sequence:CCGGCTGCGCCTAACTCGGTATTAACTCGAGTTAATACCGAGTTAGGCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006096.3-616s21c1
Sequence:CCGGGCCTACATCCTAACTCGATTTCTCGAGAAATCGAGTTAGGATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-779s1c1
Sequence:CCGGGCACATTGTGAATGACATGAACTCGAGTTCATGTCATTCACAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-507s1c1
Sequence:CCGGCCTGGAGTCCTTCAACAGTTTCTCGAGAAACTGTTGAAGGACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-587s1c1
Sequence:CCGGTGCTCTAAACAACCCTGAGATCTCGAGATCTCAGGGTTGTTTAGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006096.2-567s1c1
Sequence:CCGGGCCTACATCCTAACTCGATTTCTCGAGAAATCGAGTTAGGATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008681
VALIDATED
NDRG1 MISSION shRNA Bacterial Glycerol Stock
N-myc downstream regulated 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-629s21c1
Sequence:CCGGAGGGTCTCGTGCTCATGAATGCTCGAGCATTCATGAGCACGAGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008681.1-794s1c1
Sequence:CCGGGCAACCTACACTTATTCATCACTCGAGTGATGAATAAGTGTAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-740s21c1
Sequence:CCGGTCTTCGGCAAGGAGGAGATACCTCGAGGTATCTCCTCCTTGCCGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-815s21c1
Sequence:CCGGACCCGAGCAACCTACACTTATCTCGAGATAAGTGTAGGTTGCTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-524s21c1
Sequence:CCGGCTGGAGTCCTTCACCAGTTTGCTCGAGCAAACTGGTGAAGGACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008681.1-473s1c1
Sequence:CCGGCAATGGATCAGTTGGCTGAAACTCGAGTTTCAGCCAACTGATCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-1408s21c1
Sequence:CCGGCCTACGCTAATGCGGTATTAACTCGAGTTAATACCGCATTAGCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008681
VALIDATED
NDRG1 MISSION shRNA shRNA Plasmid DNA
N-myc downstream regulated 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-629s21c1
Sequence:CCGGAGGGTCTCGTGCTCATGAATGCTCGAGCATTCATGAGCACGAGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008681.1-794s1c1
Sequence:CCGGGCAACCTACACTTATTCATCACTCGAGTGATGAATAAGTGTAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-740s21c1
Sequence:CCGGTCTTCGGCAAGGAGGAGATACCTCGAGGTATCTCCTCCTTGCCGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-815s21c1
Sequence:CCGGACCCGAGCAACCTACACTTATCTCGAGATAAGTGTAGGTTGCTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-524s21c1
Sequence:CCGGCTGGAGTCCTTCACCAGTTTGCTCGAGCAAACTGGTGAAGGACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008681.1-473s1c1
Sequence:CCGGCAATGGATCAGTTGGCTGAAACTCGAGTTTCAGCCAACTGATCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-1408s21c1
Sequence:CCGGCCTACGCTAATGCGGTATTAACTCGAGTTAATACCGCATTAGCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008681
VALIDATED
NDRG1 MISSION shRNA Lentiviral Transduction Particles
N-myc downstream regulated 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-629s21c1
Sequence:CCGGAGGGTCTCGTGCTCATGAATGCTCGAGCATTCATGAGCACGAGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008681.1-794s1c1
Sequence:CCGGGCAACCTACACTTATTCATCACTCGAGTGATGAATAAGTGTAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-740s21c1
Sequence:CCGGTCTTCGGCAAGGAGGAGATACCTCGAGGTATCTCCTCCTTGCCGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-815s21c1
Sequence:CCGGACCCGAGCAACCTACACTTATCTCGAGATAAGTGTAGGTTGCTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-524s21c1
Sequence:CCGGCTGGAGTCCTTCACCAGTTTGCTCGAGCAAACTGGTGAAGGACTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008681.1-473s1c1
Sequence:CCGGCAATGGATCAGTTGGCTGAAACTCGAGTTTCAGCCAACTGATCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008681.2-1408s21c1
Sequence:CCGGCCTACGCTAATGCGGTATTAACTCGAGTTAATACCGCATTAGCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010884
VALIDATED
NDRG1 MISSION shRNA Bacterial Glycerol Stock
N-myc downstream regulated 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010884.1-1723s1c1
Sequence:CCGGCCTGGAAACAAACTTCTGTTTCTCGAGAAACAGAAGTTTGTTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-969s1c1
Sequence:CCGGGCAATTCTAAATTGGACCCAACTCGAGTTGGGTCCAATTTAGAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-544s1c1
Sequence:CCGGGCTCAAGAGTGTCATTGGCATCTCGAGATGCCAATGACACTCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-829s1c1
Sequence:CCGGCTTATTCATCAGCGCCTACAACTCGAGTTGTAGGCGCTGATGAATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-328s1c1
Sequence:CCGGCATCCTCACGTATCACGACATCTCGAGATGTCGTGATACGTGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010884
VALIDATED
NDRG1 MISSION shRNA shRNA Plasmid DNA
N-myc downstream regulated 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010884.1-1723s1c1
Sequence:CCGGCCTGGAAACAAACTTCTGTTTCTCGAGAAACAGAAGTTTGTTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-969s1c1
Sequence:CCGGGCAATTCTAAATTGGACCCAACTCGAGTTGGGTCCAATTTAGAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-544s1c1
Sequence:CCGGGCTCAAGAGTGTCATTGGCATCTCGAGATGCCAATGACACTCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-829s1c1
Sequence:CCGGCTTATTCATCAGCGCCTACAACTCGAGTTGTAGGCGCTGATGAATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-328s1c1
Sequence:CCGGCATCCTCACGTATCACGACATCTCGAGATGTCGTGATACGTGAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010884
VALIDATED
NDRG1 MISSION shRNA Lentiviral Transduction Particles
N-myc downstream regulated 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010884.1-1723s1c1
Sequence:CCGGCCTGGAAACAAACTTCTGTTTCTCGAGAAACAGAAGTTTGTTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-969s1c1
Sequence:CCGGGCAATTCTAAATTGGACCCAACTCGAGTTGGGTCCAATTTAGAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-544s1c1
Sequence:CCGGGCTCAAGAGTGTCATTGGCATCTCGAGATGCCAATGACACTCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-829s1c1
Sequence:CCGGCTTATTCATCAGCGCCTACAACTCGAGTTGTAGGCGCTGATGAATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010884.1-328s1c1
Sequence:CCGGCATCCTCACGTATCACGACATCTCGAGATGTCGTGATACGTGAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)