EMAIL THIS PAGE TO A FRIEND

NDRG3

NDRG family member 3

164 Gene Product Result for
Gene ID:
Mouse(29812) N-myc downstream regulated gene 3
Rat(296318) NDRG family member 3
sheep(101122617) NDRG family member 3
domestic guinea pig(100726547) NDRG family member 3
Domestic Rabbit(100353911) NDRG family member 3
naked mole-rat(101712842) NDRG family member 3
chicken(419130) NDRG family member 3
dog(477220) NDRG family member 3
cow(514399) NDRG family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022477 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022477 Rosetta Predictions human pricing
NM_032013 Rosetta Predictions human pricing
NM_001013923 Rosetta Predictions rat pricing
XM_001067405 Rosetta Predictions rat pricing
NM_013865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355757 predicted 1086
2 SASI_Hs01_00215357 predicted 658
3 SASI_Hs01_00215359 predicted 461
4 SASI_Hs01_00215360 predicted 1207
5 SASI_Hs02_00355758 predicted 350
6 SASI_Hs01_00215361 predicted 585
7 SASI_Hs01_00215362 predicted 587
8 SASI_Hs01_00215363 predicted 837
9 SASI_Hs01_00215365 predicted 1255
10 SASI_Hs01_00215366 predicted 1204
11 SASI_Hs01_00215358 predicted 376
12 SASI_Hs01_00215364 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359187 predicted 1123
2 SASI_Hs01_00034865 predicted 694
3 SASI_Hs01_00034867 predicted 496
4 SASI_Hs01_00034868 predicted 1244
5 SASI_Hs02_00359188 predicted 382
6 SASI_Hs01_00034869 predicted 617
7 SASI_Hs01_00034870 predicted 621
8 SASI_Hs01_00034871 predicted 874
9 SASI_Hs01_00034873 predicted 1289
10 SASI_Hs01_00034874 predicted 1247
11 SASI_Hs01_00034866 predicted 420
12 SASI_Hs01_00034872 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201214 predicted 1106
2 SASI_Rn02_00201215 predicted 560
3 SASI_Rn01_00050728 predicted 661
4 SASI_Rn01_00050729 predicted 704
5 SASI_Rn01_00050732 predicted 216
6 SASI_Rn01_00050733 predicted 494
7 SASI_Rn01_00050734 predicted 480
8 SASI_Rn01_00050735 predicted 228
9 SASI_Rn01_00050736 predicted 693
10 SASI_Rn02_00201216 predicted 245
11 SASI_Rn01_00050730 predicted 704
12 SASI_Rn01_00050731 predicted 700
13 SASI_Rn01_00050737 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320874 predicted 199
2 SASI_Rn02_00320875 predicted 280
3 SASI_Rn02_00320876 predicted 321
4 SASI_Rn02_00320877 predicted 252
5 SASI_Rn02_00320878 predicted 230
6 SASI_Rn02_00320879 predicted 273
7 SASI_Rn02_00320880 predicted 373
8 SASI_Rn02_00320881 predicted 287
9 SASI_Rn02_00320882 predicted 300
10 SASI_Rn02_00320883 predicted 179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190384 predicted 707
2 SASI_Mm01_00190385 predicted 567
3 SASI_Mm01_00190386 predicted 668
4 SASI_Mm01_00190387 predicted 612
5 SASI_Mm01_00190388 predicted 248
6 SASI_Mm01_00190389 predicted 202
7 SASI_Mm01_00190390 predicted 1156
8 SASI_Mm01_00190391 predicted 1116
9 SASI_Mm01_00190392 predicted 1214
10 SASI_Mm01_00190393 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013865
VALIDATED
NDRG3 MISSION shRNA Bacterial Glycerol Stock
NDRG family member 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013865.1-903s21c1
Sequence:CCGGCGACCCTATAAATACAACTTTCTCGAGAAAGTTGTATTTATAGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013865.1-1310s21c1
Sequence:CCGGCCACAGCATCTCTCTCTAGTACTCGAGTACTAGAGAGAGATGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013865.1-1380s1c1
Sequence:CCGGCCATGCCATTACTGTAACATTCTCGAGAATGTTACAGTAATGGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-903s1c1
Sequence:CCGGCGACCCTATAAATACAACTTTCTCGAGAAAGTTGTATTTATAGGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-670s1c1
Sequence:CCGGCAGGCCAATTTGGACCTCATTCTCGAGAATGAGGTCCAAATTGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-1310s1c1
Sequence:CCGGCCACAGCATCTCTCTCTAGTACTCGAGTACTAGAGAGAGATGCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013865.1-491s1c1
Sequence:CCGGGAGCCTACATTCTCAGCAGATCTCGAGATCTGCTGAGAATGTAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013865.1-670s21c1
Sequence:CCGGCAGGCCAATTTGGACCTCATTCTCGAGAATGAGGTCCAAATTGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013865.1-1380s21c1
Sequence:CCGGCCATGCCATTACTGTAACATTCTCGAGAATGTTACAGTAATGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-264s1c1
Sequence:CCGGGCTCAACCATAAGTCCTGCTTCTCGAGAAGCAGGACTTATGGTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013865.1-264s21c1
Sequence:CCGGGCTCAACCATAAGTCCTGCTTCTCGAGAAGCAGGACTTATGGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013865
VALIDATED
NDRG3 MISSION shRNA shRNA Plasmid DNA
NDRG family member 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013865.1-903s21c1
Sequence:CCGGCGACCCTATAAATACAACTTTCTCGAGAAAGTTGTATTTATAGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013865.1-1310s21c1
Sequence:CCGGCCACAGCATCTCTCTCTAGTACTCGAGTACTAGAGAGAGATGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013865.1-1380s1c1
Sequence:CCGGCCATGCCATTACTGTAACATTCTCGAGAATGTTACAGTAATGGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-903s1c1
Sequence:CCGGCGACCCTATAAATACAACTTTCTCGAGAAAGTTGTATTTATAGGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-670s1c1
Sequence:CCGGCAGGCCAATTTGGACCTCATTCTCGAGAATGAGGTCCAAATTGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-1310s1c1
Sequence:CCGGCCACAGCATCTCTCTCTAGTACTCGAGTACTAGAGAGAGATGCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013865.1-491s1c1
Sequence:CCGGGAGCCTACATTCTCAGCAGATCTCGAGATCTGCTGAGAATGTAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013865.1-670s21c1
Sequence:CCGGCAGGCCAATTTGGACCTCATTCTCGAGAATGAGGTCCAAATTGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013865.1-1380s21c1
Sequence:CCGGCCATGCCATTACTGTAACATTCTCGAGAATGTTACAGTAATGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-264s1c1
Sequence:CCGGGCTCAACCATAAGTCCTGCTTCTCGAGAAGCAGGACTTATGGTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013865.1-264s21c1
Sequence:CCGGGCTCAACCATAAGTCCTGCTTCTCGAGAAGCAGGACTTATGGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013865
VALIDATED
NDRG3 MISSION shRNA Lentiviral Transduction Particles
NDRG family member 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013865.1-903s21c1
Sequence:CCGGCGACCCTATAAATACAACTTTCTCGAGAAAGTTGTATTTATAGGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013865.1-1310s21c1
Sequence:CCGGCCACAGCATCTCTCTCTAGTACTCGAGTACTAGAGAGAGATGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013865.1-1380s1c1
Sequence:CCGGCCATGCCATTACTGTAACATTCTCGAGAATGTTACAGTAATGGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-903s1c1
Sequence:CCGGCGACCCTATAAATACAACTTTCTCGAGAAAGTTGTATTTATAGGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-670s1c1
Sequence:CCGGCAGGCCAATTTGGACCTCATTCTCGAGAATGAGGTCCAAATTGGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-1310s1c1
Sequence:CCGGCCACAGCATCTCTCTCTAGTACTCGAGTACTAGAGAGAGATGCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013865.1-491s1c1
Sequence:CCGGGAGCCTACATTCTCAGCAGATCTCGAGATCTGCTGAGAATGTAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013865.1-670s21c1
Sequence:CCGGCAGGCCAATTTGGACCTCATTCTCGAGAATGAGGTCCAAATTGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013865.1-1380s21c1
Sequence:CCGGCCATGCCATTACTGTAACATTCTCGAGAATGTTACAGTAATGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013865.1-264s1c1
Sequence:CCGGGCTCAACCATAAGTCCTGCTTCTCGAGAAGCAGGACTTATGGTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013865.1-264s21c1
Sequence:CCGGGCTCAACCATAAGTCCTGCTTCTCGAGAAGCAGGACTTATGGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022477
VALIDATED
NDRG3 MISSION shRNA Bacterial Glycerol Stock
NDRG family member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022477.2-531s21c1
Sequence:CCGGATGTTGACCCTTGCGCTAAAGCTCGAGCTTTAGCGCAAGGGTCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-1221s21c1
Sequence:CCGGCCACTCCATAATATAACATTTCTCGAGAAATGTTATATTATGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022477.2-196s1c1
Sequence:CCGGCAAAGGAAACAGACCAGTTATCTCGAGATAACTGGTCTGTTTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022477.2-873s1c1
Sequence:CCGGGCCTGAACCCTATAAATACAACTCGAGTTGTATTTATAGGGTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022477.2-238s1c1
Sequence:CCGGCCTCAACCATAAATCCTGTTTCTCGAGAAACAGGATTTATGGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-868s21c1
Sequence:CCGGTTCCCGCCTGAACCCTATAAACTCGAGTTTATAGGGTTCAGGCGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-165s21c1
Sequence:CCGGGTGTGGTCCACGTCACTATAACTCGAGTTATAGTGACGTGGACCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-231s21c1
Sequence:CCGGACATTGGCCTCAACCATAAATCTCGAGATTTATGGTTGAGGCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022477
VALIDATED
NDRG3 MISSION shRNA shRNA Plasmid DNA
NDRG family member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022477.2-531s21c1
Sequence:CCGGATGTTGACCCTTGCGCTAAAGCTCGAGCTTTAGCGCAAGGGTCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-1221s21c1
Sequence:CCGGCCACTCCATAATATAACATTTCTCGAGAAATGTTATATTATGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022477.2-196s1c1
Sequence:CCGGCAAAGGAAACAGACCAGTTATCTCGAGATAACTGGTCTGTTTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022477.2-873s1c1
Sequence:CCGGGCCTGAACCCTATAAATACAACTCGAGTTGTATTTATAGGGTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022477.2-238s1c1
Sequence:CCGGCCTCAACCATAAATCCTGTTTCTCGAGAAACAGGATTTATGGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-868s21c1
Sequence:CCGGTTCCCGCCTGAACCCTATAAACTCGAGTTTATAGGGTTCAGGCGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-165s21c1
Sequence:CCGGGTGTGGTCCACGTCACTATAACTCGAGTTATAGTGACGTGGACCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-231s21c1
Sequence:CCGGACATTGGCCTCAACCATAAATCTCGAGATTTATGGTTGAGGCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022477
VALIDATED
NDRG3 MISSION shRNA Lentiviral Transduction Particles
NDRG family member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022477.2-531s21c1
Sequence:CCGGATGTTGACCCTTGCGCTAAAGCTCGAGCTTTAGCGCAAGGGTCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-1221s21c1
Sequence:CCGGCCACTCCATAATATAACATTTCTCGAGAAATGTTATATTATGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022477.2-196s1c1
Sequence:CCGGCAAAGGAAACAGACCAGTTATCTCGAGATAACTGGTCTGTTTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022477.2-873s1c1
Sequence:CCGGGCCTGAACCCTATAAATACAACTCGAGTTGTATTTATAGGGTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022477.2-238s1c1
Sequence:CCGGCCTCAACCATAAATCCTGTTTCTCGAGAAACAGGATTTATGGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-868s21c1
Sequence:CCGGTTCCCGCCTGAACCCTATAAACTCGAGTTTATAGGGTTCAGGCGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-165s21c1
Sequence:CCGGGTGTGGTCCACGTCACTATAACTCGAGTTATAGTGACGTGGACCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022477.2-231s21c1
Sequence:CCGGACATTGGCCTCAACCATAAATCTCGAGATTTATGGTTGAGGCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)