EMAIL THIS PAGE TO A FRIEND

NDRG4

NDRG family member 4

101 Gene Product Result for
Synonyms: BDM1 SMAP-8 SMAP8
Gene ID:
Human(65009) Summary: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that is required for cell cycle progression and survival in primary astrocytes and may be involved in the regulation of mitogenic signalling in vascular smooth muscles cells. Alternative splicing results in multiple transcripts encoding different isoforms.[provided by RefSeq, Jun 2011]
Mouse(234593) N-myc downstream regulated gene 4
Rat(64457) NDRG family member 4
Zebrafish(692305) N-myc downstream regulated gene 4
chicken(768618) NDRG family member 4
dog(611099) NDRG family member 4
domestic cat(101089229) NDRG family member 4
Horse(100052493) NDRG family member 4
cow(515033) NDRG family member 4
naked mole-rat(101714252) NDRG family member 4
domestic guinea pig(100718597) NDRG family member 4
sheep(101122719) NDRG family member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020465 Rosetta Predictions human pricing
NM_022910 Rosetta Predictions human pricing
NM_031967 Rosetta Predictions rat pricing
NM_145602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048670 predicted 1055
2 SASI_Hs01_00048671 predicted 1669
3 SASI_Hs01_00048672 predicted 738
4 SASI_Hs01_00048673 predicted 1421
5 SASI_Hs01_00048674 predicted 553
6 SASI_Hs01_00048675 predicted 503
7 SASI_Hs01_00048676 predicted 495
8 SASI_Hs01_00048677 predicted 1418
9 SASI_Hs01_00048678 predicted 1351
10 SASI_Hs01_00048679 predicted 1694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132899 predicted 968
2 SASI_Hs01_00132900 predicted 1580
3 SASI_Hs01_00132901 predicted 649
4 SASI_Hs01_00132902 predicted 1332
5 SASI_Hs01_00132903 predicted 463
6 SASI_Hs01_00132904 predicted 417
7 SASI_Hs01_00132905 predicted 410
8 SASI_Hs01_00132906 predicted 1332
9 SASI_Hs01_00132907 predicted 1273
10 SASI_Hs01_00132908 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105553 predicted 1293
2 SASI_Rn01_00105554 predicted 540
3 SASI_Rn01_00105555 predicted 345
4 SASI_Rn01_00105556 predicted 1542
5 SASI_Rn01_00105557 predicted 1561
6 SASI_Rn01_00105558 predicted 1316
7 SASI_Rn01_00105559 predicted 1275
8 SASI_Rn02_00265351 predicted 1543
9 SASI_Rn01_00105561 predicted 290
10 SASI_Rn01_00105562 predicted 1261
11 SASI_Rn01_00105560 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341149 predicted 1311
2 SASI_Mm01_00096483 predicted 568
3 SASI_Mm01_00096484 predicted 1536
4 SASI_Mm01_00096485 predicted 1602
5 SASI_Mm01_00096486 predicted 201
6 SASI_Mm01_00096487 predicted 1548
7 SASI_Mm01_00096488 predicted 1585
8 SASI_Mm01_00096489 predicted 1433
9 SASI_Mm01_00096490 predicted 1552
10 SASI_Mm01_00096491 predicted 690
11 SASI_Mm01_00096492 predicted 1503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020465
NDRG4 MISSION shRNA Bacterial Glycerol Stock
NDRG family member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-291s1c1
Sequence:CCGGGCCTCAACCACAAACTATGCTCTCGAGAGCATAGTTTGTGGTTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-640s1c1
Sequence:CCGGCCTAACTAGCACTTTACCCGACTCGAGTCGGGTAAAGTGCTAGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-991s1c1
Sequence:CCGGGAAGCTGACTGAAGCCTTCAACTCGAGTTGAAGGCTTCAGTCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-268s1c1
Sequence:CCGGCATCCTCACCTACCATGATGTCTCGAGACATCATGGTAGGTGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-769s1c1
Sequence:CCGGGCTCTTCTGGAACATGTACAACTCGAGTTGTACATGTTCCAGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-1004s1c1
Sequence:CCGGGCCTTCAAATACTTCCTGCAACTCGAGTTGCAGGAAGTATTTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-766s1c1
Sequence:CCGGGCAGCTCTTCTGGAACATGTACTCGAGTACATGTTCCAGAAGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-301s1c1
Sequence:CCGGCAAACTATGCTTCAACACCTTCTCGAGAAGGTGTTGAAGCATAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-997s1c1
Sequence:CCGGGACTGAAGCCTTCAAATACTTCTCGAGAAGTATTTGAAGGCTTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020465
NDRG4 MISSION shRNA shRNA Plasmid DNA
NDRG family member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-291s1c1
Sequence:CCGGGCCTCAACCACAAACTATGCTCTCGAGAGCATAGTTTGTGGTTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-640s1c1
Sequence:CCGGCCTAACTAGCACTTTACCCGACTCGAGTCGGGTAAAGTGCTAGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-991s1c1
Sequence:CCGGGAAGCTGACTGAAGCCTTCAACTCGAGTTGAAGGCTTCAGTCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-268s1c1
Sequence:CCGGCATCCTCACCTACCATGATGTCTCGAGACATCATGGTAGGTGAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-769s1c1
Sequence:CCGGGCTCTTCTGGAACATGTACAACTCGAGTTGTACATGTTCCAGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-1004s1c1
Sequence:CCGGGCCTTCAAATACTTCCTGCAACTCGAGTTGCAGGAAGTATTTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-766s1c1
Sequence:CCGGGCAGCTCTTCTGGAACATGTACTCGAGTACATGTTCCAGAAGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-301s1c1
Sequence:CCGGCAAACTATGCTTCAACACCTTCTCGAGAAGGTGTTGAAGCATAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-997s1c1
Sequence:CCGGGACTGAAGCCTTCAAATACTTCTCGAGAAGTATTTGAAGGCTTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020465
NDRG4 MISSION shRNA Lentiviral Transduction Particles
NDRG family member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-291s1c1
Sequence:CCGGGCCTCAACCACAAACTATGCTCTCGAGAGCATAGTTTGTGGTTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-640s1c1
Sequence:CCGGCCTAACTAGCACTTTACCCGACTCGAGTCGGGTAAAGTGCTAGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-991s1c1
Sequence:CCGGGAAGCTGACTGAAGCCTTCAACTCGAGTTGAAGGCTTCAGTCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-268s1c1
Sequence:CCGGCATCCTCACCTACCATGATGTCTCGAGACATCATGGTAGGTGAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-769s1c1
Sequence:CCGGGCTCTTCTGGAACATGTACAACTCGAGTTGTACATGTTCCAGAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-1004s1c1
Sequence:CCGGGCCTTCAAATACTTCCTGCAACTCGAGTTGCAGGAAGTATTTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-766s1c1
Sequence:CCGGGCAGCTCTTCTGGAACATGTACTCGAGTACATGTTCCAGAAGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-301s1c1
Sequence:CCGGCAAACTATGCTTCAACACCTTCTCGAGAAGGTGTTGAAGCATAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020465.1-997s1c1
Sequence:CCGGGACTGAAGCCTTCAAATACTTCTCGAGAAGTATTTGAAGGCTTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145602
VALIDATED
NDRG4 MISSION shRNA Bacterial Glycerol Stock
NDRG family member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-781s21c1
Sequence:CCGGGATGCTGGTAGTCGGAGATAACTCGAGTTATCTCCGACTACCAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-714s21c1
Sequence:CCGGGCCGCAGAGACCTTGATATTACTCGAGTAATATCAAGGTCTCTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-2415s21c1
Sequence:CCGGTAGATAGCACTCCAAGTATTGCTCGAGCAATACTTGGAGTGCTATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145602.2-120s21c1
Sequence:CCGGATGACATCGAGACGCCTTATGCTCGAGCATAAGGCGTCTCGATGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-402s21c1
Sequence:CCGGTTGGGTTTAAGTACGTGATTGCTCGAGCAATCACGTACTTAAACCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145602
VALIDATED
NDRG4 MISSION shRNA shRNA Plasmid DNA
NDRG family member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-781s21c1
Sequence:CCGGGATGCTGGTAGTCGGAGATAACTCGAGTTATCTCCGACTACCAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-714s21c1
Sequence:CCGGGCCGCAGAGACCTTGATATTACTCGAGTAATATCAAGGTCTCTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-2415s21c1
Sequence:CCGGTAGATAGCACTCCAAGTATTGCTCGAGCAATACTTGGAGTGCTATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145602.2-120s21c1
Sequence:CCGGATGACATCGAGACGCCTTATGCTCGAGCATAAGGCGTCTCGATGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-402s21c1
Sequence:CCGGTTGGGTTTAAGTACGTGATTGCTCGAGCAATCACGTACTTAAACCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145602
VALIDATED
NDRG4 MISSION shRNA Lentiviral Transduction Particles
NDRG family member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-781s21c1
Sequence:CCGGGATGCTGGTAGTCGGAGATAACTCGAGTTATCTCCGACTACCAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-714s21c1
Sequence:CCGGGCCGCAGAGACCTTGATATTACTCGAGTAATATCAAGGTCTCTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-2415s21c1
Sequence:CCGGTAGATAGCACTCCAAGTATTGCTCGAGCAATACTTGGAGTGCTATCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145602.2-120s21c1
Sequence:CCGGATGACATCGAGACGCCTTATGCTCGAGCATAAGGCGTCTCGATGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145602.2-402s21c1
Sequence:CCGGTTGGGTTTAAGTACGTGATTGCTCGAGCAATCACGTACTTAAACCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)