EMAIL THIS PAGE TO A FRIEND

NDST1

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

177 Gene Product Result for
Synonyms: HSST NST1
UniProtKB ID: P52848, Q96E57
Gene ID:
Mouse(15531) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Rat(29633) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
sheep(101102810) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
domestic guinea pig(100727889) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
naked mole-rat(101725305) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Domestic Rabbit(100344304) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
chicken(416274) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
domestic cat(101083399) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
cow(514172) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Horse(100060315) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
dog(489185) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001543 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001543 Rosetta Predictions human pricing
NM_024361 Rosetta Predictions rat pricing
NM_008306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120612 predicted 2413
2 SASI_Hs01_00120613 predicted 1321
3 SASI_Hs01_00120614 predicted 1394
4 SASI_Hs01_00120615 predicted 2302
5 SASI_Hs01_00120617 predicted 2989
6 SASI_Hs01_00120618 predicted 717
7 SASI_Hs01_00120619 predicted 645
8 SASI_Hs01_00120620 predicted 2973
9 SASI_Hs01_00120621 predicted 2782
10 SASI_Hs02_00332084 predicted 2176
11 SASI_Hs01_00120616 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067314 predicted 2701
2 SASI_Rn01_00067316 predicted 2511
3 SASI_Rn02_00263941 predicted 2241
4 SASI_Rn01_00067317 predicted 2213
5 SASI_Rn01_00067318 predicted 938
6 SASI_Rn01_00067319 predicted 2140
7 SASI_Rn01_00067320 predicted 1372
8 SASI_Rn01_00067321 predicted 1478
9 SASI_Rn01_00067322 predicted 982
10 SASI_Rn01_00067323 predicted 2052
11 SASI_Rn01_00067315 predicted 2218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093031 predicted 409
2 SASI_Mm01_00093032 predicted 1924
3 SASI_Mm01_00093033 predicted 2135
4 SASI_Mm01_00093034 predicted 1082
5 SASI_Mm01_00093035 predicted 1161
6 SASI_Mm01_00093036 predicted 1134
7 SASI_Mm01_00093038 predicted 2185
8 SASI_Mm01_00093039 predicted 1949
9 SASI_Mm02_00313613 predicted 1752
10 SASI_Mm02_00313614 predicted 2571
11 SASI_Mm01_00093037 predicted 1858
12 SASI_Mm01_00093040 predicted 1351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008306
VALIDATED
NDST1 MISSION shRNA Bacterial Glycerol Stock
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-2418s21c1
Sequence:CCGGGCTGGTATGCCACTCATATTGCTCGAGCAATATGAGTGGCATACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-1189s21c1
Sequence:CCGGCCGCACACATATTCCAAACTTCTCGAGAAGTTTGGAATATGTGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008306.4-1089s21c1
Sequence:CCGGGATACATCCTGGTGGATATTGCTCGAGCAATATCCACCAGGATGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-3072s21c1
Sequence:CCGGCCTGTTGTTGGAAGGTCATTTCTCGAGAAATGACCTTCCAACAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-2552s21c1
Sequence:CCGGAGCACTGTCGACTACCATAAACTCGAGTTTATGGTAGTCGACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008306.2-3752s1c1
Sequence:CCGGCCCAAATACTAAGAAGCTAAACTCGAGTTTAGCTTCTTAGTATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-1087s1c1
Sequence:CCGGCCGATACATCCTGGTGGATATCTCGAGATATCCACCAGGATGTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-722s1c1
Sequence:CCGGCATTCGAACCTGGGCTTGAAACTCGAGTTTCAAGCCCAGGTTCGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-2327s1c1
Sequence:CCGGGCCCTAAAGTACACCTTTCATCTCGAGATGAAAGGTGTACTTTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-1189s1c1
Sequence:CCGGCCGCACACATATTCCAAACTTCTCGAGAAGTTTGGAATATGTGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008306
VALIDATED
NDST1 MISSION shRNA shRNA Plasmid DNA
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-2418s21c1
Sequence:CCGGGCTGGTATGCCACTCATATTGCTCGAGCAATATGAGTGGCATACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-1189s21c1
Sequence:CCGGCCGCACACATATTCCAAACTTCTCGAGAAGTTTGGAATATGTGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008306.4-1089s21c1
Sequence:CCGGGATACATCCTGGTGGATATTGCTCGAGCAATATCCACCAGGATGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-3072s21c1
Sequence:CCGGCCTGTTGTTGGAAGGTCATTTCTCGAGAAATGACCTTCCAACAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-2552s21c1
Sequence:CCGGAGCACTGTCGACTACCATAAACTCGAGTTTATGGTAGTCGACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008306.2-3752s1c1
Sequence:CCGGCCCAAATACTAAGAAGCTAAACTCGAGTTTAGCTTCTTAGTATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-1087s1c1
Sequence:CCGGCCGATACATCCTGGTGGATATCTCGAGATATCCACCAGGATGTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-722s1c1
Sequence:CCGGCATTCGAACCTGGGCTTGAAACTCGAGTTTCAAGCCCAGGTTCGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-2327s1c1
Sequence:CCGGGCCCTAAAGTACACCTTTCATCTCGAGATGAAAGGTGTACTTTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-1189s1c1
Sequence:CCGGCCGCACACATATTCCAAACTTCTCGAGAAGTTTGGAATATGTGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008306
VALIDATED
NDST1 MISSION shRNA Lentiviral Transduction Particles
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-2418s21c1
Sequence:CCGGGCTGGTATGCCACTCATATTGCTCGAGCAATATGAGTGGCATACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-1189s21c1
Sequence:CCGGCCGCACACATATTCCAAACTTCTCGAGAAGTTTGGAATATGTGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008306.4-1089s21c1
Sequence:CCGGGATACATCCTGGTGGATATTGCTCGAGCAATATCCACCAGGATGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-3072s21c1
Sequence:CCGGCCTGTTGTTGGAAGGTCATTTCTCGAGAAATGACCTTCCAACAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008306.4-2552s21c1
Sequence:CCGGAGCACTGTCGACTACCATAAACTCGAGTTTATGGTAGTCGACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008306.2-3752s1c1
Sequence:CCGGCCCAAATACTAAGAAGCTAAACTCGAGTTTAGCTTCTTAGTATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-1087s1c1
Sequence:CCGGCCGATACATCCTGGTGGATATCTCGAGATATCCACCAGGATGTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-722s1c1
Sequence:CCGGCATTCGAACCTGGGCTTGAAACTCGAGTTTCAAGCCCAGGTTCGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-2327s1c1
Sequence:CCGGGCCCTAAAGTACACCTTTCATCTCGAGATGAAAGGTGTACTTTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008306.2-1189s1c1
Sequence:CCGGCCGCACACATATTCCAAACTTCTCGAGAAGTTTGGAATATGTGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001543
VALIDATED
NDST1 MISSION shRNA Bacterial Glycerol Stock
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001543.3-6456s21c1
Sequence:CCGGCAGCGATGTCTGCTATCTAATCTCGAGATTAGATAGCAGACATCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-2923s21c1
Sequence:CCGGGCCTTCCTGAAGGACTATTACCTCGAGGTAATAGTCCTTCAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-1967s21c1
Sequence:CCGGTGACGCACCTGTCCAACTATGCTCGAGCATAGTTGGACAGGTGCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-698s21c1
Sequence:CCGGTGGAGTCCAGCCGCTTCAAATCTCGAGATTTGAAGCGGCTGGACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-485s21c1
Sequence:CCGGTCTCGGCCTACTACCTATATGCTCGAGCATATAGGTAGTAGGCCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001543.3-6738s1c1
Sequence:CCGGCCCTGTACTTTCAAGGATAATCTCGAGATTATCCTTGAAAGTACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001543.3-2419s1c1
Sequence:CCGGGCCAACTACTTTGATTCAGAACTCGAGTTCTGAATCAAAGTAGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001543.3-1518s1c1
Sequence:CCGGGCTGTCGTATGTGAAGGAGTTCTCGAGAACTCCTTCACATACGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001543.3-2560s1c1
Sequence:CCGGGCCCTAAAGTACACCTTCCATCTCGAGATGGAAGGTGTACTTTAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001543.3-453s1c1
Sequence:CCGGGCTGTTCATCTTCTGCCTGTTCTCGAGAACAGGCAGAAGATGAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001543
VALIDATED
NDST1 MISSION shRNA shRNA Plasmid DNA
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001543.3-6456s21c1
Sequence:CCGGCAGCGATGTCTGCTATCTAATCTCGAGATTAGATAGCAGACATCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-2923s21c1
Sequence:CCGGGCCTTCCTGAAGGACTATTACCTCGAGGTAATAGTCCTTCAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-1967s21c1
Sequence:CCGGTGACGCACCTGTCCAACTATGCTCGAGCATAGTTGGACAGGTGCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-698s21c1
Sequence:CCGGTGGAGTCCAGCCGCTTCAAATCTCGAGATTTGAAGCGGCTGGACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-485s21c1
Sequence:CCGGTCTCGGCCTACTACCTATATGCTCGAGCATATAGGTAGTAGGCCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001543.3-6738s1c1
Sequence:CCGGCCCTGTACTTTCAAGGATAATCTCGAGATTATCCTTGAAAGTACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001543.3-2419s1c1
Sequence:CCGGGCCAACTACTTTGATTCAGAACTCGAGTTCTGAATCAAAGTAGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001543.3-1518s1c1
Sequence:CCGGGCTGTCGTATGTGAAGGAGTTCTCGAGAACTCCTTCACATACGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001543.3-2560s1c1
Sequence:CCGGGCCCTAAAGTACACCTTCCATCTCGAGATGGAAGGTGTACTTTAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001543.3-453s1c1
Sequence:CCGGGCTGTTCATCTTCTGCCTGTTCTCGAGAACAGGCAGAAGATGAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001543
VALIDATED
NDST1 MISSION shRNA Lentiviral Transduction Particles
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001543.3-6456s21c1
Sequence:CCGGCAGCGATGTCTGCTATCTAATCTCGAGATTAGATAGCAGACATCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-2923s21c1
Sequence:CCGGGCCTTCCTGAAGGACTATTACCTCGAGGTAATAGTCCTTCAGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-1967s21c1
Sequence:CCGGTGACGCACCTGTCCAACTATGCTCGAGCATAGTTGGACAGGTGCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-698s21c1
Sequence:CCGGTGGAGTCCAGCCGCTTCAAATCTCGAGATTTGAAGCGGCTGGACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001543.3-485s21c1
Sequence:CCGGTCTCGGCCTACTACCTATATGCTCGAGCATATAGGTAGTAGGCCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001543.3-6738s1c1
Sequence:CCGGCCCTGTACTTTCAAGGATAATCTCGAGATTATCCTTGAAAGTACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001543.3-2419s1c1
Sequence:CCGGGCCAACTACTTTGATTCAGAACTCGAGTTCTGAATCAAAGTAGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001543.3-1518s1c1
Sequence:CCGGGCTGTCGTATGTGAAGGAGTTCTCGAGAACTCCTTCACATACGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001543.3-2560s1c1
Sequence:CCGGGCCCTAAAGTACACCTTCCATCTCGAGATGGAAGGTGTACTTTAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001543.3-453s1c1
Sequence:CCGGGCTGTTCATCTTCTGCCTGTTCTCGAGAACAGGCAGAAGATGAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)