EMAIL THIS PAGE TO A FRIEND

NDST2

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2

93 Gene Product Result for
Synonyms: HSST2 NST2
UniProtKB ID: P52849, Q2TB32, Q59H89
Gene ID:
Human(8509) Summary: This gene encodes a member of the N-deacetylase/N-sulfotransferase subfamily of the sulfotransferase 1 proteins. The encoded enzyme has dual functions in processing glucosamine and heparin polymers, including N-deacetylation and N-sulfation. The encoded protein may be localized to the Golgi. [provided by RefSeq, Feb 2009]
Mouse(17423) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Rat(114002) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Zebrafish(798226) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
cow(286838) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Horse(100064113) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
domestic cat(101088957) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
dog(489049) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
chicken(423738) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Domestic Rabbit(100357859) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
naked mole-rat(101717521) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
domestic guinea pig(100725589) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
sheep(101120545) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003635 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003635 Rosetta Predictions human pricing
NM_001105740 Rosetta Predictions rat pricing
NM_010811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132889 predicted 2468
2 SASI_Hs01_00132890 predicted 2507
3 SASI_Hs01_00132891 predicted 2810
4 SASI_Hs01_00132892 predicted 2858
5 SASI_Hs01_00132893 predicted 1877
6 SASI_Hs01_00132894 predicted 2496
7 SASI_Hs01_00132895 predicted 1483
8 SASI_Hs01_00132896 predicted 1427
9 SASI_Hs01_00132898 predicted 2637
10 SASI_Hs02_00335989 predicted 2293
11 SASI_Hs01_00132897 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212066 predicted 1705
2 SASI_Rn02_00212067 predicted 2151
3 SASI_Rn02_00212068 predicted 2653
4 SASI_Rn02_00212069 predicted 1857
5 SASI_Rn02_00212070 predicted 2919
6 SASI_Rn02_00212071 predicted 2861
7 SASI_Rn02_00212072 predicted 895
8 SASI_Rn02_00212073 predicted 2155
9 SASI_Rn02_00212074 predicted 2740
10 SASI_Rn02_00212075 predicted 2572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175001 predicted 2972
2 SASI_Mm01_00175002 predicted 2559
3 SASI_Mm01_00175003 predicted 1578
4 SASI_Mm01_00175004 predicted 3037
5 SASI_Mm01_00175005 predicted 1146
6 SASI_Mm01_00175006 predicted 2939
7 SASI_Mm01_00175007 predicted 806
8 SASI_Mm01_00175008 predicted 1061
9 SASI_Mm01_00175009 predicted 1678
10 SASI_Mm01_00175010 predicted 1415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003635
VALIDATED
NDST2 MISSION shRNA Bacterial Glycerol Stock
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003635.2-956s1c1
Sequence:CCGGCCGCTATGTCTTGGTCATTTACTCGAGTAAATGACCAAGACATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-1045s21c1
Sequence:CCGGAGTATGGTGTGGGCATCATTGCTCGAGCAATGATGCCCACACCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003635.2-2727s1c1
Sequence:CCGGGCTCTGAACTATACCTTCTATCTCGAGATAGAAGGTATAGTTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003635.2-3519s21c1
Sequence:CCGGATCCGCAGCAGTGTATCTATTCTCGAGAATAGATACACTGCTGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003635.2-2108s1c1
Sequence:CCGGGCTGCTTAATCCGATCAGCATCTCGAGATGCTGATCGGATTAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003635.2-2253s1c1
Sequence:CCGGGCACAGAAGTACTTTGAACTTCTCGAGAAGTTCAAAGTACTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003635.2-3110s1c1
Sequence:CCGGCCGGAACCATAATTTGGAGTTCTCGAGAACTCCAAATTATGGTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-2486s21c1
Sequence:CCGGGTTCTTCAACAGCCCTAATTACTCGAGTAATTAGGGCTGTTGAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-1628s21c1
Sequence:CCGGCTCGGGCAAGTTCTATCATACCTCGAGGTATGATAGAACTTGCCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-956s21c1
Sequence:CCGGCCGCTATGTCTTGGTCATTTACTCGAGTAAATGACCAAGACATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003635
VALIDATED
NDST2 MISSION shRNA shRNA Plasmid DNA
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003635.2-956s1c1
Sequence:CCGGCCGCTATGTCTTGGTCATTTACTCGAGTAAATGACCAAGACATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-1045s21c1
Sequence:CCGGAGTATGGTGTGGGCATCATTGCTCGAGCAATGATGCCCACACCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003635.2-2727s1c1
Sequence:CCGGGCTCTGAACTATACCTTCTATCTCGAGATAGAAGGTATAGTTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003635.2-3519s21c1
Sequence:CCGGATCCGCAGCAGTGTATCTATTCTCGAGAATAGATACACTGCTGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003635.2-2108s1c1
Sequence:CCGGGCTGCTTAATCCGATCAGCATCTCGAGATGCTGATCGGATTAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003635.2-2253s1c1
Sequence:CCGGGCACAGAAGTACTTTGAACTTCTCGAGAAGTTCAAAGTACTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003635.2-3110s1c1
Sequence:CCGGCCGGAACCATAATTTGGAGTTCTCGAGAACTCCAAATTATGGTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-2486s21c1
Sequence:CCGGGTTCTTCAACAGCCCTAATTACTCGAGTAATTAGGGCTGTTGAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-1628s21c1
Sequence:CCGGCTCGGGCAAGTTCTATCATACCTCGAGGTATGATAGAACTTGCCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-956s21c1
Sequence:CCGGCCGCTATGTCTTGGTCATTTACTCGAGTAAATGACCAAGACATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003635
VALIDATED
NDST2 MISSION shRNA Lentiviral Transduction Particles
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003635.2-956s1c1
Sequence:CCGGCCGCTATGTCTTGGTCATTTACTCGAGTAAATGACCAAGACATAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-1045s21c1
Sequence:CCGGAGTATGGTGTGGGCATCATTGCTCGAGCAATGATGCCCACACCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003635.2-2727s1c1
Sequence:CCGGGCTCTGAACTATACCTTCTATCTCGAGATAGAAGGTATAGTTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003635.2-3519s21c1
Sequence:CCGGATCCGCAGCAGTGTATCTATTCTCGAGAATAGATACACTGCTGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003635.2-2108s1c1
Sequence:CCGGGCTGCTTAATCCGATCAGCATCTCGAGATGCTGATCGGATTAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003635.2-2253s1c1
Sequence:CCGGGCACAGAAGTACTTTGAACTTCTCGAGAAGTTCAAAGTACTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003635.2-3110s1c1
Sequence:CCGGCCGGAACCATAATTTGGAGTTCTCGAGAACTCCAAATTATGGTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-2486s21c1
Sequence:CCGGGTTCTTCAACAGCCCTAATTACTCGAGTAATTAGGGCTGTTGAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-1628s21c1
Sequence:CCGGCTCGGGCAAGTTCTATCATACCTCGAGGTATGATAGAACTTGCCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003635.2-956s21c1
Sequence:CCGGCCGCTATGTCTTGGTCATTTACTCGAGTAAATGACCAAGACATAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010811
VALIDATED
NDST2 MISSION shRNA Bacterial Glycerol Stock
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-2708s1c1
Sequence:CCGGCGGAACCATAATTTGGAGCTACTCGAGTAGCTCCAAATTATGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-3108s1c1
Sequence:CCGGCCCAGCAGTTTACCTGTCAATCTCGAGATTGACAGGTAAACTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-2411s1c1
Sequence:CCGGCCTGGCTACTATTCTACCCATCTCGAGATGGGTAGAATAGTAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-1087s1c1
Sequence:CCGGCCGCTACATCTTAGTAGATATCTCGAGATATCTACTAAGATGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-2240s1c1
Sequence:CCGGGCCAAGATAATCACTGTGCTTCTCGAGAAGCACAGTGATTATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010811.2-2836s21c1
Sequence:CCGGGCCAAGATAATCACTGTGCTTCTCGAGAAGCACAGTGATTATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010811.2-3055s21c1
Sequence:CCGGTCTGGACAGTTGCTGATTATGCTCGAGCATAATCAGCAACTGTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010811.2-1456s21c1
Sequence:CCGGACTTATGAGCCCGTGCTTATTCTCGAGAATAAGCACGGGCTCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010811.2-1680s21c1
Sequence:CCGGCCGCTACATCTTAGTAGATATCTCGAGATATCTACTAAGATGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010811.2-3704s21c1
Sequence:CCGGCCCAGCAGTTTACCTGTCAATCTCGAGATTGACAGGTAAACTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010811
VALIDATED
NDST2 MISSION shRNA shRNA Plasmid DNA
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-2708s1c1
Sequence:CCGGCGGAACCATAATTTGGAGCTACTCGAGTAGCTCCAAATTATGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-3108s1c1
Sequence:CCGGCCCAGCAGTTTACCTGTCAATCTCGAGATTGACAGGTAAACTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-2411s1c1
Sequence:CCGGCCTGGCTACTATTCTACCCATCTCGAGATGGGTAGAATAGTAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-1087s1c1
Sequence:CCGGCCGCTACATCTTAGTAGATATCTCGAGATATCTACTAAGATGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-2240s1c1
Sequence:CCGGGCCAAGATAATCACTGTGCTTCTCGAGAAGCACAGTGATTATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010811.2-2836s21c1
Sequence:CCGGGCCAAGATAATCACTGTGCTTCTCGAGAAGCACAGTGATTATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010811.2-3055s21c1
Sequence:CCGGTCTGGACAGTTGCTGATTATGCTCGAGCATAATCAGCAACTGTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010811.2-1456s21c1
Sequence:CCGGACTTATGAGCCCGTGCTTATTCTCGAGAATAAGCACGGGCTCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010811.2-1680s21c1
Sequence:CCGGCCGCTACATCTTAGTAGATATCTCGAGATATCTACTAAGATGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010811.2-3704s21c1
Sequence:CCGGCCCAGCAGTTTACCTGTCAATCTCGAGATTGACAGGTAAACTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010811
VALIDATED
NDST2 MISSION shRNA Lentiviral Transduction Particles
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-2708s1c1
Sequence:CCGGCGGAACCATAATTTGGAGCTACTCGAGTAGCTCCAAATTATGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-3108s1c1
Sequence:CCGGCCCAGCAGTTTACCTGTCAATCTCGAGATTGACAGGTAAACTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-2411s1c1
Sequence:CCGGCCTGGCTACTATTCTACCCATCTCGAGATGGGTAGAATAGTAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-1087s1c1
Sequence:CCGGCCGCTACATCTTAGTAGATATCTCGAGATATCTACTAAGATGTAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010811.1-2240s1c1
Sequence:CCGGGCCAAGATAATCACTGTGCTTCTCGAGAAGCACAGTGATTATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010811.2-2836s21c1
Sequence:CCGGGCCAAGATAATCACTGTGCTTCTCGAGAAGCACAGTGATTATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010811.2-3055s21c1
Sequence:CCGGTCTGGACAGTTGCTGATTATGCTCGAGCATAATCAGCAACTGTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010811.2-1456s21c1
Sequence:CCGGACTTATGAGCCCGTGCTTATTCTCGAGAATAAGCACGGGCTCATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010811.2-1680s21c1
Sequence:CCGGCCGCTACATCTTAGTAGATATCTCGAGATATCTACTAAGATGTAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010811.2-3704s21c1
Sequence:CCGGCCCAGCAGTTTACCTGTCAATCTCGAGATTGACAGGTAAACTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)