EMAIL THIS PAGE TO A FRIEND

NDST4

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4

59 Gene Product Result for
Synonyms: NDST-4 NHSST4
UniProtKB ID: Q9H3R1
Gene ID:
Mouse(64580) N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Rat(362035) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
naked mole-rat(101703600) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
domestic guinea pig(100721517) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
sheep(101112819) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
chicken(422686) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
cow(529260) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
Horse(100064177) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
domestic cat(101097478) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
dog(487911) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022569 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051231 MISSION® esiRNA esiRNA human NDST4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022569 Rosetta Predictions human pricing
XM_001075825 Rosetta Predictions rat pricing
XM_342336 Rosetta Predictions rat pricing
NM_022565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355861 predicted 2653
2 SASI_Hs01_00200136 predicted 3045
3 SASI_Hs01_00200137 predicted 2933
4 SASI_Hs01_00200138 predicted 2463
5 SASI_Hs01_00200139 predicted 3035
6 SASI_Hs01_00200140 predicted 936
7 SASI_Hs01_00200143 predicted 2907
8 SASI_Hs01_00200144 predicted 2090
9 SASI_Hs01_00200145 predicted 1467
10 SASI_Hs02_00355862 predicted 2198
11 SASI_Hs01_00200141 predicted 1021
12 SASI_Hs01_00200142 predicted 2686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351188 predicted 2008
2 SASI_Rn02_00351189 predicted 487
3 SASI_Rn02_00351190 predicted 991
4 SASI_Rn02_00351191 predicted 1666
5 SASI_Rn02_00351192 predicted 2027
6 SASI_Rn02_00351193 predicted 1616
7 SASI_Rn02_00351194 predicted 1374
8 SASI_Rn02_00351195 predicted 2464
9 SASI_Rn02_00351196 predicted 358
10 SASI_Rn02_00351197 predicted 2159
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394127 predicted 2011
2 SASI_Rn02_00394128 predicted 486
3 SASI_Rn02_00394129 predicted 986
4 SASI_Rn02_00394130 predicted 1668
5 SASI_Rn02_00394131 predicted 2026
6 SASI_Rn02_00394132 predicted 571
7 SASI_Rn02_00394133 predicted 1614
8 SASI_Rn02_00394134 predicted 1375
9 SASI_Rn02_00394135 predicted 2465
10 SASI_Rn02_00394136 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163425 predicted 3009
2 SASI_Mm01_00163426 predicted 2650
3 SASI_Mm02_00326624 predicted 1394
4 SASI_Mm01_00163427 predicted 2884
5 SASI_Mm01_00163428 predicted 2152
6 SASI_Mm01_00163429 predicted 2560
7 SASI_Mm02_00326625 predicted 1324
8 SASI_Mm01_00163432 predicted 2170
9 SASI_Mm01_00163433 predicted 2580
10 SASI_Mm01_00163430 predicted 2223
11 SASI_Mm01_00163431 predicted 1652
12 SASI_Mm01_00163434 predicted 1269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022565
NDST4 MISSION shRNA Bacterial Glycerol Stock
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-2247s1c1
Sequence:CCGGGCCCTGAGGTTCAATTTCTATCTCGAGATAGAAATTGAACCTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-2106s1c1
Sequence:CCGGGCTAACTACTTCCACTCAGAACTCGAGTTCTGAGTGGAAGTAGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-1081s1c1
Sequence:CCGGAGGCATTACTAGAGACTCAAACTCGAGTTTGAGTCTCTAGTAATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-1688s1c1
Sequence:CCGGCGGCTTATACACCTTTGTGAACTCGAGTTCACAAAGGTGTATAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-1386s1c1
Sequence:CCGGCCAGTCCATATTCAGTTGTATCTCGAGATACAACTGAATATGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022565.2-823s21c1
Sequence:CCGGGACCTCCCTTATCGGTCTATACTCGAGTATAGACCGATAAGGGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022565.2-1120s21c1
Sequence:CCGGGAATACAGTGTTAGCATAATTCTCGAGAATTATGCTAACACTGTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022565.2-2371s21c1
Sequence:CCGGCAGAATCCATGCGACGATAAACTCGAGTTTATCGTCGCATGGATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022565
NDST4 MISSION shRNA shRNA Plasmid DNA
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-2247s1c1
Sequence:CCGGGCCCTGAGGTTCAATTTCTATCTCGAGATAGAAATTGAACCTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-2106s1c1
Sequence:CCGGGCTAACTACTTCCACTCAGAACTCGAGTTCTGAGTGGAAGTAGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-1081s1c1
Sequence:CCGGAGGCATTACTAGAGACTCAAACTCGAGTTTGAGTCTCTAGTAATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-1688s1c1
Sequence:CCGGCGGCTTATACACCTTTGTGAACTCGAGTTCACAAAGGTGTATAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-1386s1c1
Sequence:CCGGCCAGTCCATATTCAGTTGTATCTCGAGATACAACTGAATATGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022565.2-823s21c1
Sequence:CCGGGACCTCCCTTATCGGTCTATACTCGAGTATAGACCGATAAGGGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022565.2-1120s21c1
Sequence:CCGGGAATACAGTGTTAGCATAATTCTCGAGAATTATGCTAACACTGTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022565.2-2371s21c1
Sequence:CCGGCAGAATCCATGCGACGATAAACTCGAGTTTATCGTCGCATGGATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022565
NDST4 MISSION shRNA Lentiviral Transduction Particles
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-2247s1c1
Sequence:CCGGGCCCTGAGGTTCAATTTCTATCTCGAGATAGAAATTGAACCTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-2106s1c1
Sequence:CCGGGCTAACTACTTCCACTCAGAACTCGAGTTCTGAGTGGAAGTAGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-1081s1c1
Sequence:CCGGAGGCATTACTAGAGACTCAAACTCGAGTTTGAGTCTCTAGTAATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-1688s1c1
Sequence:CCGGCGGCTTATACACCTTTGTGAACTCGAGTTCACAAAGGTGTATAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022565.1-1386s1c1
Sequence:CCGGCCAGTCCATATTCAGTTGTATCTCGAGATACAACTGAATATGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022565.2-823s21c1
Sequence:CCGGGACCTCCCTTATCGGTCTATACTCGAGTATAGACCGATAAGGGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022565.2-1120s21c1
Sequence:CCGGGAATACAGTGTTAGCATAATTCTCGAGAATTATGCTAACACTGTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022565.2-2371s21c1
Sequence:CCGGCAGAATCCATGCGACGATAAACTCGAGTTTATCGTCGCATGGATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022569
NDST4 MISSION shRNA Bacterial Glycerol Stock
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-2051s1c1
Sequence:CCGGCGGTACAGAAAGGGCTTCATTCTCGAGAATGAAGCCCTTTCTGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-3206s1c1
Sequence:CCGGCGAGATCATAATGTGGAACTACTCGAGTAGTTCCACATTATGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-1191s1c1
Sequence:CCGGGCTTACCAAGTACACAATTAACTCGAGTTAATTGTGTACTTGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-2527s1c1
Sequence:CCGGGCATCCTTCAATCATCAGCAACTCGAGTTGCTGATGATTGAAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022569.1-3037s21c1
Sequence:CCGGGGGAGTTACACCTCGTTATAACTCGAGTTATAACGAGGTGTAACTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022569.1-2253s21c1
Sequence:CCGGATGACCGCCTAGGGTTATATACTCGAGTATATAACCCTAGGCGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022569.1-1143s21c1
Sequence:CCGGTGGAATACAGTGTTAGTATAACTCGAGTTATACTAACACTGTATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022569
NDST4 MISSION shRNA shRNA Plasmid DNA
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-2051s1c1
Sequence:CCGGCGGTACAGAAAGGGCTTCATTCTCGAGAATGAAGCCCTTTCTGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-3206s1c1
Sequence:CCGGCGAGATCATAATGTGGAACTACTCGAGTAGTTCCACATTATGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-1191s1c1
Sequence:CCGGGCTTACCAAGTACACAATTAACTCGAGTTAATTGTGTACTTGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-2527s1c1
Sequence:CCGGGCATCCTTCAATCATCAGCAACTCGAGTTGCTGATGATTGAAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022569.1-3037s21c1
Sequence:CCGGGGGAGTTACACCTCGTTATAACTCGAGTTATAACGAGGTGTAACTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022569.1-2253s21c1
Sequence:CCGGATGACCGCCTAGGGTTATATACTCGAGTATATAACCCTAGGCGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022569.1-1143s21c1
Sequence:CCGGTGGAATACAGTGTTAGTATAACTCGAGTTATACTAACACTGTATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022569
NDST4 MISSION shRNA Lentiviral Transduction Particles
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-2051s1c1
Sequence:CCGGCGGTACAGAAAGGGCTTCATTCTCGAGAATGAAGCCCTTTCTGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-3206s1c1
Sequence:CCGGCGAGATCATAATGTGGAACTACTCGAGTAGTTCCACATTATGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-1191s1c1
Sequence:CCGGGCTTACCAAGTACACAATTAACTCGAGTTAATTGTGTACTTGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022569.1-2527s1c1
Sequence:CCGGGCATCCTTCAATCATCAGCAACTCGAGTTGCTGATGATTGAAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022569.1-3037s21c1
Sequence:CCGGGGGAGTTACACCTCGTTATAACTCGAGTTATAACGAGGTGTAACTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022569.1-2253s21c1
Sequence:CCGGATGACCGCCTAGGGTTATATACTCGAGTATATAACCCTAGGCGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022569.1-1143s21c1
Sequence:CCGGTGGAATACAGTGTTAGTATAACTCGAGTTATACTAACACTGTATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)