EMAIL THIS PAGE TO A FRIEND

NDUFA13

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13

59 Gene Product Result for
Synonyms: B16.6 CDA016 GRIM-19 GRIM19
UniProtKB ID: Q9P0J0, Q6PKI0, Q9H2L3, Q9Y327
Gene ID:
Human(51079) Summary: This gene encodes a subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), which functions in the transfer of electrons from NADH to the respiratory chain. The protein is required for complex I assembly and electron transfer activity. The protein binds the signal transducers and activators of transcription 3 (STAT3) transcription factor, and can function as a tumor suppressor. The human protein purified from mitochondria migrates at approximately 16 kDa. Transcripts originating from an upstream promoter and capable of expressing a protein with a longer N-terminus have been found, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]
Mouse(67184) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
Rat(314759) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
Zebrafish(393687) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
domestic cat(101100189) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
cow(338084) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
dog(476659) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
domestic guinea pig(100719394) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
naked mole-rat(101721624) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
sheep(101104823) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023312 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023312 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023312 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015965 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028201 MISSION® esiRNA esiRNA human NDUFA13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015965 Rosetta Predictions human pricing
XM_001080448 Rosetta Predictions rat pricing
XM_235062 Rosetta Predictions rat pricing
NM_023312 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192719 predicted 601
2 SASI_Hs01_00192725 predicted 370
3 SASI_Hs01_00192720 predicted 553
4 SASI_Hs01_00192721 predicted 495
5 SASI_Hs01_00192722 predicted 549
6 SASI_Hs01_00192724 predicted 754
7 SASI_Hs01_00192726 predicted 423
8 SASI_Hs01_00192727 predicted 509
9 SASI_Hs02_00348632 predicted 826
10 SASI_Hs01_00192728 predicted 572
11 SASI_Hs01_00192723 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368008 predicted 251
2 SASI_Rn02_00368009 predicted 256
3 SASI_Rn02_00368010 predicted 256
4 SASI_Rn02_00368011 predicted 248
5 SASI_Rn02_00368012 predicted 249
6 SASI_Rn02_00368013 predicted 253
7 SASI_Rn02_00368014 predicted 210
8 SASI_Rn02_00368015 predicted 247
9 SASI_Rn02_00368016 predicted 258
10 SASI_Rn02_00368017 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388941 predicted 246
2 SASI_Rn02_00388942 predicted 259
3 SASI_Rn02_00388943 predicted 251
4 SASI_Rn02_00388944 predicted 244
5 SASI_Rn02_00388945 predicted 245
6 SASI_Rn02_00388946 predicted 251
7 SASI_Rn02_00388947 predicted 205
8 SASI_Rn02_00388948 predicted 245
9 SASI_Rn02_00388949 predicted 261
10 SASI_Rn02_00388950 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107268 predicted 1018
2 SASI_Mm01_00107275 predicted 782
3 SASI_Mm01_00107269 predicted 1022
4 SASI_Mm01_00107276 predicted 890
5 SASI_Mm01_00107270 predicted 937
6 SASI_Mm01_00107277 predicted 778
7 SASI_Mm02_00327040 predicted 972
8 SASI_Mm02_00327041 predicted 778
9 SASI_Mm02_00327042 predicted 992
10 SASI_Mm01_00107271 predicted 940
11 SASI_Mm01_00107272 predicted 1016
12 SASI_Mm01_00107273 predicted 1028
13 SASI_Mm01_00107274 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023312
VALIDATED
NDUFA13 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-1050s21c1
Sequence:CCGGAGGAGGAAGCCATCATCATGACTCGAGTCATGATGATGGCTTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-919s21c1
Sequence:CCGGGAGAATGATGAGGTGGAACCACTCGAGTGGTTCCACCTCATCATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-1101s21c1
Sequence:CCGGCTGTGTTCCATACCACACGATCTCGAGATCGTGTGGTATGGAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-829s21c1
Sequence:CCGGCATCGACTACAAGCGGAACCTCTCGAGAGGTTCCGCTTGTAGTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-900s1c1
Sequence:CCGGCCTTGATCTTTGGCTACTGGACTCGAGTCCAGTAGCCAAAGATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-919s1c1
Sequence:CCGGGAGAATGATGAGGTGGAACCACTCGAGTGGTTCCACCTCATCATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-907s1c1
Sequence:CCGGCTTTGGCTACTGGAGAATGATCTCGAGATCATTCTCCAGTAGCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-1101s1c1
Sequence:CCGGCTGTGTTCCATACCACACGATCTCGAGATCGTGTGGTATGGAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023312.2-1023s1c1
Sequence:CCGGCCCTGCAGATTCTCCGGGAAACTCGAGTTTCCCGGAGAATCTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-900s21c1
Sequence:CCGGCCTTGATCTTTGGCTACTGGACTCGAGTCCAGTAGCCAAAGATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023312
VALIDATED
NDUFA13 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-1050s21c1
Sequence:CCGGAGGAGGAAGCCATCATCATGACTCGAGTCATGATGATGGCTTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-919s21c1
Sequence:CCGGGAGAATGATGAGGTGGAACCACTCGAGTGGTTCCACCTCATCATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-1101s21c1
Sequence:CCGGCTGTGTTCCATACCACACGATCTCGAGATCGTGTGGTATGGAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-829s21c1
Sequence:CCGGCATCGACTACAAGCGGAACCTCTCGAGAGGTTCCGCTTGTAGTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-900s1c1
Sequence:CCGGCCTTGATCTTTGGCTACTGGACTCGAGTCCAGTAGCCAAAGATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-919s1c1
Sequence:CCGGGAGAATGATGAGGTGGAACCACTCGAGTGGTTCCACCTCATCATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-907s1c1
Sequence:CCGGCTTTGGCTACTGGAGAATGATCTCGAGATCATTCTCCAGTAGCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-1101s1c1
Sequence:CCGGCTGTGTTCCATACCACACGATCTCGAGATCGTGTGGTATGGAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023312.2-1023s1c1
Sequence:CCGGCCCTGCAGATTCTCCGGGAAACTCGAGTTTCCCGGAGAATCTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-900s21c1
Sequence:CCGGCCTTGATCTTTGGCTACTGGACTCGAGTCCAGTAGCCAAAGATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023312
VALIDATED
NDUFA13 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-1050s21c1
Sequence:CCGGAGGAGGAAGCCATCATCATGACTCGAGTCATGATGATGGCTTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-919s21c1
Sequence:CCGGGAGAATGATGAGGTGGAACCACTCGAGTGGTTCCACCTCATCATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-1101s21c1
Sequence:CCGGCTGTGTTCCATACCACACGATCTCGAGATCGTGTGGTATGGAACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-829s21c1
Sequence:CCGGCATCGACTACAAGCGGAACCTCTCGAGAGGTTCCGCTTGTAGTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-900s1c1
Sequence:CCGGCCTTGATCTTTGGCTACTGGACTCGAGTCCAGTAGCCAAAGATCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-919s1c1
Sequence:CCGGGAGAATGATGAGGTGGAACCACTCGAGTGGTTCCACCTCATCATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-907s1c1
Sequence:CCGGCTTTGGCTACTGGAGAATGATCTCGAGATCATTCTCCAGTAGCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023312.2-1101s1c1
Sequence:CCGGCTGTGTTCCATACCACACGATCTCGAGATCGTGTGGTATGGAACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023312.2-1023s1c1
Sequence:CCGGCCCTGCAGATTCTCCGGGAAACTCGAGTTTCCCGGAGAATCTGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023312.2-900s21c1
Sequence:CCGGCCTTGATCTTTGGCTACTGGACTCGAGTCCAGTAGCCAAAGATCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015965
VALIDATED
NDUFA13 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-640s21c1
Sequence:CCGGCTACGGGCACTGGAGCATAATCTCGAGATTATGCTCCAGTGCCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-491s21c1
Sequence:CCGGGTGTGGGATACTGCGAGTATGCTCGAGCATACTCGCAGTATCCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-555s21c1
Sequence:CCGGATGGGCCCATCGACTACAAACCTCGAGGTTTGTAGTCGATGGGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-608s21c1
Sequence:CCGGAGCATGCTGGCCATAGGGATTCTCGAGAATCCCTATGGCCAGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015965.3-634s1c1
Sequence:CCGGGCGCCTACAAATCGAGGACTTCTCGAGAAGTCCTCGATTTGTAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015965.3-324s1c1
Sequence:CCGGCGCGGTCGGATAGTTACACTACTCGAGTAGTGTAACTATCCGACCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015965.3-601s1c1
Sequence:CCGGCTGGAGCATAATGAAGTGGAACTCGAGTTCCACTTCATTATGCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015965.3-571s1c1
Sequence:CCGGCATAGGGATTGGAACCCTGATCTCGAGATCAGGGTTCCAATCCCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015965.3-514s1c1
Sequence:CCGGCATCGACTACAAACGGAACTTCTCGAGAAGTTCCGTTTGTAGTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015965
VALIDATED
NDUFA13 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-640s21c1
Sequence:CCGGCTACGGGCACTGGAGCATAATCTCGAGATTATGCTCCAGTGCCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-491s21c1
Sequence:CCGGGTGTGGGATACTGCGAGTATGCTCGAGCATACTCGCAGTATCCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-555s21c1
Sequence:CCGGATGGGCCCATCGACTACAAACCTCGAGGTTTGTAGTCGATGGGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-608s21c1
Sequence:CCGGAGCATGCTGGCCATAGGGATTCTCGAGAATCCCTATGGCCAGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015965.3-634s1c1
Sequence:CCGGGCGCCTACAAATCGAGGACTTCTCGAGAAGTCCTCGATTTGTAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015965.3-324s1c1
Sequence:CCGGCGCGGTCGGATAGTTACACTACTCGAGTAGTGTAACTATCCGACCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015965.3-601s1c1
Sequence:CCGGCTGGAGCATAATGAAGTGGAACTCGAGTTCCACTTCATTATGCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015965.3-571s1c1
Sequence:CCGGCATAGGGATTGGAACCCTGATCTCGAGATCAGGGTTCCAATCCCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015965.3-514s1c1
Sequence:CCGGCATCGACTACAAACGGAACTTCTCGAGAAGTTCCGTTTGTAGTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015965
VALIDATED
NDUFA13 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-640s21c1
Sequence:CCGGCTACGGGCACTGGAGCATAATCTCGAGATTATGCTCCAGTGCCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-491s21c1
Sequence:CCGGGTGTGGGATACTGCGAGTATGCTCGAGCATACTCGCAGTATCCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-555s21c1
Sequence:CCGGATGGGCCCATCGACTACAAACCTCGAGGTTTGTAGTCGATGGGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015965.5-608s21c1
Sequence:CCGGAGCATGCTGGCCATAGGGATTCTCGAGAATCCCTATGGCCAGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015965.3-634s1c1
Sequence:CCGGGCGCCTACAAATCGAGGACTTCTCGAGAAGTCCTCGATTTGTAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015965.3-324s1c1
Sequence:CCGGCGCGGTCGGATAGTTACACTACTCGAGTAGTGTAACTATCCGACCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015965.3-601s1c1
Sequence:CCGGCTGGAGCATAATGAAGTGGAACTCGAGTTCCACTTCATTATGCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015965.3-571s1c1
Sequence:CCGGCATAGGGATTGGAACCCTGATCTCGAGATCAGGGTTCCAATCCCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015965.3-514s1c1
Sequence:CCGGCATCGACTACAAACGGAACTTCTCGAGAAGTTCCGTTTGTAGTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)