EMAIL THIS PAGE TO A FRIEND

NDUFA2

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa

60 Gene Product Result for
Synonyms: B8 CD14 CIB8
UniProtKB ID: O43678, D6RJD6, Q6IAY8
Gene ID:
Human(4695) Summary: The encoded protein is a subunit of the hydrophobic protein fraction of the NADH:ubiquinone oxidoreductase (complex 1), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane, and may be involved in regulating complex I activity or its assembly via assistance in redox processes. Mutations in this gene are associated with Leigh syndrome, an early-onset progressive neurodegenerative disorder. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(17991) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2
Rat(291660) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2
domestic guinea pig(100725776) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
naked mole-rat(101709230) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
sheep(101119470) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
Zebrafish(554125) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2
cow(327698) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
domestic cat(101096376) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
dog(478032) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
chicken(768860) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002488 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002488 Rosetta Predictions human pricing
NM_001106153 Rosetta Predictions rat pricing
NM_010885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087010 predicted 340
2 SASI_Hs02_00333925 predicted 334
3 SASI_Hs01_00087012 predicted 272
4 SASI_Hs02_00333926 predicted 335
5 SASI_Hs02_00333927 predicted 289
6 SASI_Hs02_00333928 predicted 271
7 SASI_Hs01_00087014 predicted 280
8 SASI_Hs01_00087015 predicted 312
9 SASI_Hs01_00087017 predicted 339
10 SASI_Hs02_00333929 predicted 337
11 SASI_Hs01_00087011 predicted 235
12 SASI_Hs01_00087013 predicted 223
13 SASI_Hs01_00087016 predicted 340
14 SASI_Hs01_00087018 predicted 208
15 SASI_Hs01_00087019 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216148 predicted 246
2 SASI_Rn02_00216149 predicted 277
3 SASI_Rn02_00216150 predicted 293
4 SASI_Rn02_00216151 predicted 296
5 SASI_Rn02_00216152 predicted 205
6 SASI_Rn02_00216153 predicted 245
7 SASI_Rn02_00216154 predicted 210
8 SASI_Rn02_00216155 predicted 299
9 SASI_Rn02_00216156 predicted 336
10 SASI_Rn02_00216157 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178189 predicted 248
2 SASI_Mm01_00178190 predicted 241
3 SASI_Mm01_00178191 predicted 249
4 SASI_Mm01_00178192 predicted 280
5 SASI_Mm01_00178193 predicted 209
6 SASI_Mm01_00178194 predicted 213
7 SASI_Mm02_00319580 predicted 217
8 SASI_Mm01_00178195 predicted 295
9 SASI_Mm01_00178196 predicted 296
10 SASI_Mm01_00178197 predicted 205
11 SASI_Mm01_00178198 predicted 293
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010885
VALIDATED
NDUFA2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-78s1c1
Sequence:CCGGCGTGAGATTCGCGTTCACTTACTCGAGTAAGTGAACGCGAATCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-303s1c1
Sequence:CCGGCAGAATGTGCTAAGCGGCAAACTCGAGTTTGCCGCTTAGCACATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-88s1c1
Sequence:CCGGGCGTTCACTTATGCCAGCGTTCTCGAGAACGCTGGCATAAGTGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-180s1c1
Sequence:CCGGCTGCCCATTCTGATCCGCGAACTCGAGTTCGCGGATCAGAATGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010885.2-281s1c1
Sequence:CCGGTGATGAGGTAACCAGAGCCATCTCGAGATGGCTCTGGTTACCTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-126s21c1
Sequence:CCGGTGAGGGATTTCATCGTGCAACCTCGAGGTTGCACGATGAAATCCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-280s21c1
Sequence:CCGGTGATGAGGTAACCAGAGCCATCTCGAGATGGCTCTGGTTACCTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-77s21c1
Sequence:CCGGCGTGAGATTCGCGTTCACTTACTCGAGTAAGTGAACGCGAATCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-302s21c1
Sequence:CCGGCAGAATGTGCTAAGCGGCAAACTCGAGTTTGCCGCTTAGCACATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-359s21c1
Sequence:CCGGAGCTGAACCTGCTGGACTGAACTCGAGTTCAGTCCAGCAGGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010885
VALIDATED
NDUFA2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-78s1c1
Sequence:CCGGCGTGAGATTCGCGTTCACTTACTCGAGTAAGTGAACGCGAATCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-303s1c1
Sequence:CCGGCAGAATGTGCTAAGCGGCAAACTCGAGTTTGCCGCTTAGCACATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-88s1c1
Sequence:CCGGGCGTTCACTTATGCCAGCGTTCTCGAGAACGCTGGCATAAGTGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-180s1c1
Sequence:CCGGCTGCCCATTCTGATCCGCGAACTCGAGTTCGCGGATCAGAATGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010885.2-281s1c1
Sequence:CCGGTGATGAGGTAACCAGAGCCATCTCGAGATGGCTCTGGTTACCTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-126s21c1
Sequence:CCGGTGAGGGATTTCATCGTGCAACCTCGAGGTTGCACGATGAAATCCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-280s21c1
Sequence:CCGGTGATGAGGTAACCAGAGCCATCTCGAGATGGCTCTGGTTACCTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-77s21c1
Sequence:CCGGCGTGAGATTCGCGTTCACTTACTCGAGTAAGTGAACGCGAATCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-302s21c1
Sequence:CCGGCAGAATGTGCTAAGCGGCAAACTCGAGTTTGCCGCTTAGCACATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-359s21c1
Sequence:CCGGAGCTGAACCTGCTGGACTGAACTCGAGTTCAGTCCAGCAGGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010885
VALIDATED
NDUFA2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-78s1c1
Sequence:CCGGCGTGAGATTCGCGTTCACTTACTCGAGTAAGTGAACGCGAATCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-303s1c1
Sequence:CCGGCAGAATGTGCTAAGCGGCAAACTCGAGTTTGCCGCTTAGCACATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-88s1c1
Sequence:CCGGGCGTTCACTTATGCCAGCGTTCTCGAGAACGCTGGCATAAGTGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010885.2-180s1c1
Sequence:CCGGCTGCCCATTCTGATCCGCGAACTCGAGTTCGCGGATCAGAATGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010885.2-281s1c1
Sequence:CCGGTGATGAGGTAACCAGAGCCATCTCGAGATGGCTCTGGTTACCTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-126s21c1
Sequence:CCGGTGAGGGATTTCATCGTGCAACCTCGAGGTTGCACGATGAAATCCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-280s21c1
Sequence:CCGGTGATGAGGTAACCAGAGCCATCTCGAGATGGCTCTGGTTACCTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-77s21c1
Sequence:CCGGCGTGAGATTCGCGTTCACTTACTCGAGTAAGTGAACGCGAATCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-302s21c1
Sequence:CCGGCAGAATGTGCTAAGCGGCAAACTCGAGTTTGCCGCTTAGCACATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010885.4-359s21c1
Sequence:CCGGAGCTGAACCTGCTGGACTGAACTCGAGTTCAGTCCAGCAGGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002488
VALIDATED
NDUFA2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002488.2-347s1c1
Sequence:CCGGGAGAACGTTCTAAGTGGTAAACTCGAGTTTACCACTTAGAACGTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002488.2-122s1c1
Sequence:CCGGCGTGAGATTCGCATCCACTTACTCGAGTAAGTGGATGCGAATCTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002488.2-169s1c1
Sequence:CCGGCGTCAGGGACTTCATTGAGAACTCGAGTTCTCAATGAAGTCCCTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002488.2-305s1c1
Sequence:CCGGCCTTTGAACAACTTCAGTGCTCTCGAGAGCACTGAAGTTGTTCAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002488.2-289s1c1
Sequence:CCGGCCAAGAGACGAATGTCCCTTTCTCGAGAAAGGGACATTCGTCTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002488
VALIDATED
NDUFA2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002488.2-347s1c1
Sequence:CCGGGAGAACGTTCTAAGTGGTAAACTCGAGTTTACCACTTAGAACGTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002488.2-122s1c1
Sequence:CCGGCGTGAGATTCGCATCCACTTACTCGAGTAAGTGGATGCGAATCTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002488.2-169s1c1
Sequence:CCGGCGTCAGGGACTTCATTGAGAACTCGAGTTCTCAATGAAGTCCCTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002488.2-305s1c1
Sequence:CCGGCCTTTGAACAACTTCAGTGCTCTCGAGAGCACTGAAGTTGTTCAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002488.2-289s1c1
Sequence:CCGGCCAAGAGACGAATGTCCCTTTCTCGAGAAAGGGACATTCGTCTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002488
VALIDATED
NDUFA2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002488.2-347s1c1
Sequence:CCGGGAGAACGTTCTAAGTGGTAAACTCGAGTTTACCACTTAGAACGTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002488.2-122s1c1
Sequence:CCGGCGTGAGATTCGCATCCACTTACTCGAGTAAGTGGATGCGAATCTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002488.2-169s1c1
Sequence:CCGGCGTCAGGGACTTCATTGAGAACTCGAGTTCTCAATGAAGTCCCTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002488.2-305s1c1
Sequence:CCGGCCTTTGAACAACTTCAGTGCTCTCGAGAGCACTGAAGTTGTTCAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002488.2-289s1c1
Sequence:CCGGCCAAGAGACGAATGTCCCTTTCTCGAGAAAGGGACATTCGTCTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)