EMAIL THIS PAGE TO A FRIEND

NDUFA4

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa

47 Gene Product Result for
Synonyms: CI-9k CI-MLRQ MLRQ
UniProtKB ID: O00483, A4D109, Q6FHN5
Gene ID:
Human(4697) Summary: The protein encoded by this gene belongs to the complex I 9kDa subunit family. Mammalian complex I of mitochondrial respiratory chain is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. [provided by RefSeq, Jul 2008]
Mouse(17992) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4
Rat(681024) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4
Zebrafish(406298) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4
chicken(772135) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
cow(327704) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
domestic cat(101099952) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
dog(477682) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
domestic guinea pig(100715622) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
sheep(101122593) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002489 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002489 Rosetta Predictions human pricing
NM_001127684 Rosetta Predictions rat pricing
NM_010886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130451 predicted 510
2 SASI_Hs01_00130453 predicted 487
3 SASI_Hs01_00130454 predicted 243
4 SASI_Hs01_00130455 predicted 569
5 SASI_Hs01_00130456 predicted 586
6 SASI_Hs01_00130458 predicted 581
7 SASI_Hs01_00130459 predicted 590
8 SASI_Hs01_00130460 predicted 324
9 SASI_Hs02_00333930 predicted 508
10 SASI_Hs02_00333931 predicted 590
11 SASI_Hs01_00130452 predicted 507
12 SASI_Hs01_00130457 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254870 predicted 211
2 SASI_Rn02_00254871 predicted 252
3 SASI_Rn02_00254872 predicted 228
4 SASI_Rn02_00254873 predicted 228
5 SASI_Rn02_00254874 predicted 229
6 SASI_Rn02_00254875 predicted 253
7 SASI_Rn02_00254876 predicted 231
8 SASI_Rn02_00254877 predicted 223
9 SASI_Rn02_00254878 predicted 205
10 SASI_Rn02_00254879 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024137 predicted 167
2 SASI_Mm01_00024138 predicted 237
3 SASI_Mm01_00024139 predicted 394
4 SASI_Mm01_00024140 predicted 115
5 SASI_Mm01_00024141 predicted 245
6 SASI_Mm01_00024142 predicted 317
7 SASI_Mm02_00319581 predicted 88
8 SASI_Mm01_00024143 predicted 339
9 SASI_Mm01_00024144 predicted 256
10 SASI_Mm01_00024145 predicted 156
11 SASI_Mm01_00024136 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010886
VALIDATED
NDUFA4 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-340s1c1
Sequence:CCGGGTTCACTGTAAAGCTGCTGATCTCGAGATCAGCAGCTTTACAGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-277s1c1
Sequence:CCGGCTACTCTGTGAATGTGGACTACTCGAGTAGTCCACATTCACAGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-123s1c1
Sequence:CCGGGCTTGATTCCTCTCTTCGTATCTCGAGATACGAAGAGAGGAATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-293s1c1
Sequence:CCGGGACTACAGCAAACTGAAGAAACTCGAGTTTCTTCAGTTTGCTGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-242s1c1
Sequence:CCGGTGGAACAAACTGGGTCCCAATCTCGAGATTGGGACCCAGTTTGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010886.2-257s21c1
Sequence:CCGGCCAATGAACAATATAAGTTCTCTCGAGAGAACTTATATTGTTCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010886.2-169s21c1
Sequence:CCGGGCACTGTATGTGATGCGCTTGCTCGAGCAAGCGCATCACATACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010886
VALIDATED
NDUFA4 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-340s1c1
Sequence:CCGGGTTCACTGTAAAGCTGCTGATCTCGAGATCAGCAGCTTTACAGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-277s1c1
Sequence:CCGGCTACTCTGTGAATGTGGACTACTCGAGTAGTCCACATTCACAGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-123s1c1
Sequence:CCGGGCTTGATTCCTCTCTTCGTATCTCGAGATACGAAGAGAGGAATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-293s1c1
Sequence:CCGGGACTACAGCAAACTGAAGAAACTCGAGTTTCTTCAGTTTGCTGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-242s1c1
Sequence:CCGGTGGAACAAACTGGGTCCCAATCTCGAGATTGGGACCCAGTTTGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010886.2-257s21c1
Sequence:CCGGCCAATGAACAATATAAGTTCTCTCGAGAGAACTTATATTGTTCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010886.2-169s21c1
Sequence:CCGGGCACTGTATGTGATGCGCTTGCTCGAGCAAGCGCATCACATACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010886
VALIDATED
NDUFA4 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-340s1c1
Sequence:CCGGGTTCACTGTAAAGCTGCTGATCTCGAGATCAGCAGCTTTACAGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-277s1c1
Sequence:CCGGCTACTCTGTGAATGTGGACTACTCGAGTAGTCCACATTCACAGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-123s1c1
Sequence:CCGGGCTTGATTCCTCTCTTCGTATCTCGAGATACGAAGAGAGGAATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-293s1c1
Sequence:CCGGGACTACAGCAAACTGAAGAAACTCGAGTTTCTTCAGTTTGCTGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010886.1-242s1c1
Sequence:CCGGTGGAACAAACTGGGTCCCAATCTCGAGATTGGGACCCAGTTTGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010886.2-257s21c1
Sequence:CCGGCCAATGAACAATATAAGTTCTCTCGAGAGAACTTATATTGTTCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010886.2-169s21c1
Sequence:CCGGGCACTGTATGTGATGCGCTTGCTCGAGCAAGCGCATCACATACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002489
VALIDATED
NDUFA4 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002489.2-179s1c1
Sequence:CCGGCCCTCTTTGTATTTATTGGAACTCGAGTTCCAATAAATACAAAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002489.2-343s1c1
Sequence:CCGGAGCAAGCTGAAGAAGGAACGTCTCGAGACGTTCCTTCTTCAGCTTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002489.2-215s1c1
Sequence:CCGGCAACACTGTATCTCTTGCGTCCTCGAGGACGCAAGAGATACAGTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002489.2-242s1c1
Sequence:CCGGTGTTCAATCCAGATGTTTGTTCTCGAGAACAAACATCTGGATTGAACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002489.2-238s1c1
Sequence:CCGGGCATTGTTCAATCCAGATGTTCTCGAGAACATCTGGATTGAACAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-482s21c1
Sequence:CCGGATCATGTTGGAGATCTCTATTCTCGAGAATAGAGATCTCCAACATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-242s21c1
Sequence:CCGGTGTTCAATCCAGATGTTTGTTCTCGAGAACAAACATCTGGATTGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-356s21c1
Sequence:CCGGAGGAACGTCCAGATTTCTAAACTCGAGTTTAGAAATCTGGACGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-343s21c1
Sequence:CCGGAGCAAGCTGAAGAAGGAACGTCTCGAGACGTTCCTTCTTCAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-253s21c1
Sequence:CCGGGATGTTTGTTGGGACAGAAATCTCGAGATTTCTGTCCCAACAAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002489
VALIDATED
NDUFA4 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002489.2-179s1c1
Sequence:CCGGCCCTCTTTGTATTTATTGGAACTCGAGTTCCAATAAATACAAAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002489.2-343s1c1
Sequence:CCGGAGCAAGCTGAAGAAGGAACGTCTCGAGACGTTCCTTCTTCAGCTTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002489.2-215s1c1
Sequence:CCGGCAACACTGTATCTCTTGCGTCCTCGAGGACGCAAGAGATACAGTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002489.2-242s1c1
Sequence:CCGGTGTTCAATCCAGATGTTTGTTCTCGAGAACAAACATCTGGATTGAACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002489.2-238s1c1
Sequence:CCGGGCATTGTTCAATCCAGATGTTCTCGAGAACATCTGGATTGAACAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-482s21c1
Sequence:CCGGATCATGTTGGAGATCTCTATTCTCGAGAATAGAGATCTCCAACATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-242s21c1
Sequence:CCGGTGTTCAATCCAGATGTTTGTTCTCGAGAACAAACATCTGGATTGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-356s21c1
Sequence:CCGGAGGAACGTCCAGATTTCTAAACTCGAGTTTAGAAATCTGGACGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-343s21c1
Sequence:CCGGAGCAAGCTGAAGAAGGAACGTCTCGAGACGTTCCTTCTTCAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-253s21c1
Sequence:CCGGGATGTTTGTTGGGACAGAAATCTCGAGATTTCTGTCCCAACAAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002489
VALIDATED
NDUFA4 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002489.2-179s1c1
Sequence:CCGGCCCTCTTTGTATTTATTGGAACTCGAGTTCCAATAAATACAAAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002489.2-343s1c1
Sequence:CCGGAGCAAGCTGAAGAAGGAACGTCTCGAGACGTTCCTTCTTCAGCTTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002489.2-215s1c1
Sequence:CCGGCAACACTGTATCTCTTGCGTCCTCGAGGACGCAAGAGATACAGTGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002489.2-242s1c1
Sequence:CCGGTGTTCAATCCAGATGTTTGTTCTCGAGAACAAACATCTGGATTGAACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002489.2-238s1c1
Sequence:CCGGGCATTGTTCAATCCAGATGTTCTCGAGAACATCTGGATTGAACAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-482s21c1
Sequence:CCGGATCATGTTGGAGATCTCTATTCTCGAGAATAGAGATCTCCAACATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-242s21c1
Sequence:CCGGTGTTCAATCCAGATGTTTGTTCTCGAGAACAAACATCTGGATTGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-356s21c1
Sequence:CCGGAGGAACGTCCAGATTTCTAAACTCGAGTTTAGAAATCTGGACGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-343s21c1
Sequence:CCGGAGCAAGCTGAAGAAGGAACGTCTCGAGACGTTCCTTCTTCAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002489.2-253s21c1
Sequence:CCGGGATGTTTGTTGGGACAGAAATCTCGAGATTTCTGTCCCAACAAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)