EMAIL THIS PAGE TO A FRIEND

NDUFA5

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5

68 Gene Product Result for
Synonyms: B13 CI-13KD-B CI-13kB NUFM UQOR13
UniProtKB ID: Q16718, B2RD98, Q6IRX7
Gene ID:
Human(4698) Summary: The human NDUFA5 gene codes for the B13 subunit of complex I of the respiratory chain, which transfers electrons from NADH to ubiquinone. The high degree of conservation of NDUFA5 extending to plants and fungi indicates its functional significance in the enzyme complex. The protein localizes to the inner mitochondrial membrane as part of the 7 component-containing, water soluble 'iron-sulfur protein' (IP) fraction of complex I, although its specific role is unknown. It is assumed to undergo post-translational removal of the initiator methionine and N-acetylation of the next amino acid. The predicted secondary structure is primarily alpha helix, but the carboxy-terminal half of the protein has high potential to adopt a coiled-coil form. The amino-terminal part contains a putative beta sheet rich in hydrophobic amino acids that may serve as mitochondrial import signal. Related pseudogenes have also been identified on four other chromosomes. [provided by RefSeq, Jul 2008]
Mouse(68202) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5
Rat(25488) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 5
Zebrafish(541328) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5
chicken(417753) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa
cow(327714) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa
domestic cat(101092508) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa
dog(475214) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa
naked mole-rat(101701548) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa
domestic guinea pig(100723200) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5
sheep(101123463) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005000 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005000 Rosetta Predictions human pricing
NM_012985 Rosetta Predictions rat pricing
NM_026614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115375 predicted 452
2 SASI_Hs01_00115376 predicted 647
3 SASI_Hs01_00115378 predicted 439
4 SASI_Hs01_00115379 predicted 520
5 SASI_Hs01_00115380 predicted 511
6 SASI_Hs01_00115381 predicted 231
7 SASI_Hs01_00115382 predicted 444
8 SASI_Hs02_00338742 predicted 204
9 SASI_Hs01_00115383 predicted 237
10 SASI_Hs01_00115384 predicted 312
11 SASI_Hs01_00115377 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038857 predicted 306
2 SASI_Rn01_00038858 predicted 201
3 SASI_Rn01_00038859 predicted 278
4 SASI_Rn01_00038860 predicted 270
5 SASI_Rn01_00038861 predicted 208
6 SASI_Rn01_00038862 predicted 199
7 SASI_Rn01_00038863 predicted 319
8 SASI_Rn01_00038864 predicted 296
9 SASI_Rn01_00038865 predicted 245
10 SASI_Rn02_00260608 predicted 212
11 SASI_Rn01_00038866 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081211 predicted 204
2 SASI_Mm01_00081212 predicted 222
3 SASI_Mm01_00081213 predicted 217
4 SASI_Mm01_00081214 predicted 311
5 SASI_Mm01_00081215 predicted 247
6 SASI_Mm01_00081216 predicted 200
7 SASI_Mm02_00330578 predicted 219
8 SASI_Mm01_00081218 predicted 291
9 SASI_Mm01_00081219 predicted 284
10 SASI_Mm02_00330579 predicted 315
11 SASI_Mm01_00081210 predicted 200
12 SASI_Mm01_00081217 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005000
VALIDATED
NDUFA5 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005000.2-275s1c1
Sequence:CCGGCTGGCTATGGTTAAAGCGGAACTCGAGTTCCGCTTTAACCATAGCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-167s1c1
Sequence:CCGGCCTCACGAGAGGCTAAGAATACTCGAGTATTCTTAGCCTCTCGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005000.2-169s21c1
Sequence:CCGGTCACGAGAGGCTAAGAATATTCTCGAGAATATTCTTAGCCTCTCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-436s1c1
Sequence:CCGGCGATCAGTGGAAATGGCCAATCTCGAGATTGGCCATTTCCACTGATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-209s1c1
Sequence:CCGGGTTCTTGAGGAAATCCCTAAACTCGAGTTTAGGGATTTCCTCAAGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-344s1c1
Sequence:CCGGGAGGTGATTCTTCAGGCTGAACTCGAGTTCAGCCTGAAGAATCACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005000.2-319s21c1
Sequence:CCGGCCAACTTCAAGGCGGTCAATTCTCGAGAATTGACCGCCTTGAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005000.2-439s21c1
Sequence:CCGGTCAGTGGAAATGGCCAATATACTCGAGTATATTGGCCATTTCCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005000.2-737s21c1
Sequence:CCGGTTCAATGCAGAGACCATAATCCTCGAGGATTATGGTCTCTGCATTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005000.2-269s21c1
Sequence:CCGGGAGAAGCTGGCTATGGTTAAACTCGAGTTTAACCATAGCCAGCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005000
VALIDATED
NDUFA5 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005000.2-275s1c1
Sequence:CCGGCTGGCTATGGTTAAAGCGGAACTCGAGTTCCGCTTTAACCATAGCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-167s1c1
Sequence:CCGGCCTCACGAGAGGCTAAGAATACTCGAGTATTCTTAGCCTCTCGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005000.2-169s21c1
Sequence:CCGGTCACGAGAGGCTAAGAATATTCTCGAGAATATTCTTAGCCTCTCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-436s1c1
Sequence:CCGGCGATCAGTGGAAATGGCCAATCTCGAGATTGGCCATTTCCACTGATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-209s1c1
Sequence:CCGGGTTCTTGAGGAAATCCCTAAACTCGAGTTTAGGGATTTCCTCAAGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-344s1c1
Sequence:CCGGGAGGTGATTCTTCAGGCTGAACTCGAGTTCAGCCTGAAGAATCACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005000.2-319s21c1
Sequence:CCGGCCAACTTCAAGGCGGTCAATTCTCGAGAATTGACCGCCTTGAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005000.2-439s21c1
Sequence:CCGGTCAGTGGAAATGGCCAATATACTCGAGTATATTGGCCATTTCCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005000.2-737s21c1
Sequence:CCGGTTCAATGCAGAGACCATAATCCTCGAGGATTATGGTCTCTGCATTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005000.2-269s21c1
Sequence:CCGGGAGAAGCTGGCTATGGTTAAACTCGAGTTTAACCATAGCCAGCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005000
VALIDATED
NDUFA5 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005000.2-275s1c1
Sequence:CCGGCTGGCTATGGTTAAAGCGGAACTCGAGTTCCGCTTTAACCATAGCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-167s1c1
Sequence:CCGGCCTCACGAGAGGCTAAGAATACTCGAGTATTCTTAGCCTCTCGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005000.2-169s21c1
Sequence:CCGGTCACGAGAGGCTAAGAATATTCTCGAGAATATTCTTAGCCTCTCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-436s1c1
Sequence:CCGGCGATCAGTGGAAATGGCCAATCTCGAGATTGGCCATTTCCACTGATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-209s1c1
Sequence:CCGGGTTCTTGAGGAAATCCCTAAACTCGAGTTTAGGGATTTCCTCAAGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_005000.2-344s1c1
Sequence:CCGGGAGGTGATTCTTCAGGCTGAACTCGAGTTCAGCCTGAAGAATCACCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005000.2-319s21c1
Sequence:CCGGCCAACTTCAAGGCGGTCAATTCTCGAGAATTGACCGCCTTGAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005000.2-439s21c1
Sequence:CCGGTCAGTGGAAATGGCCAATATACTCGAGTATATTGGCCATTTCCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005000.2-737s21c1
Sequence:CCGGTTCAATGCAGAGACCATAATCCTCGAGGATTATGGTCTCTGCATTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005000.2-269s21c1
Sequence:CCGGGAGAAGCTGGCTATGGTTAAACTCGAGTTTAACCATAGCCAGCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026614
VALIDATED
NDUFA5 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026614.2-204s21c1
Sequence:CCGGCGAGAGGCTCACAATATTGTACTCGAGTACAATATTGTGAGCCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-378s1c1
Sequence:CCGGAGGTGATTCTTCAGGCTGAAACTCGAGTTTCAGCCTGAAGAATCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-253s1c1
Sequence:CCGGCTTTCCTAAACATGCAGCCTACTCGAGTAGGCTGCATGTTTAGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-350s1c1
Sequence:CCGGGCCTTGCTTCAGGGTGGTGAACTCGAGTTCACCACCCTGAAGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-205s1c1
Sequence:CCGGCGAGAGGCTCACAATATTGTACTCGAGTACAATATTGTGAGCCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-368s1c1
Sequence:CCGGGAAGTGGAAGAGGTGATTCTTCTCGAGAAGAATCACCTCTTCCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026614.2-367s21c1
Sequence:CCGGGAAGTGGAAGAGGTGATTCTTCTCGAGAAGAATCACCTCTTCCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026614.2-295s21c1
Sequence:CCGGACCAACGAGAAGCTGGATATGCTCGAGCATATCCAGCTTCTCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026614.2-349s21c1
Sequence:CCGGGCCTTGCTTCAGGGTGGTGAACTCGAGTTCACCACCCTGAAGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026614.2-318s21c1
Sequence:CCGGCAAGGCGGAGCCAGATGTTAACTCGAGTTAACATCTGGCTCCGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026614
VALIDATED
NDUFA5 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026614.2-204s21c1
Sequence:CCGGCGAGAGGCTCACAATATTGTACTCGAGTACAATATTGTGAGCCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-378s1c1
Sequence:CCGGAGGTGATTCTTCAGGCTGAAACTCGAGTTTCAGCCTGAAGAATCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-253s1c1
Sequence:CCGGCTTTCCTAAACATGCAGCCTACTCGAGTAGGCTGCATGTTTAGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-350s1c1
Sequence:CCGGGCCTTGCTTCAGGGTGGTGAACTCGAGTTCACCACCCTGAAGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-205s1c1
Sequence:CCGGCGAGAGGCTCACAATATTGTACTCGAGTACAATATTGTGAGCCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-368s1c1
Sequence:CCGGGAAGTGGAAGAGGTGATTCTTCTCGAGAAGAATCACCTCTTCCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026614.2-367s21c1
Sequence:CCGGGAAGTGGAAGAGGTGATTCTTCTCGAGAAGAATCACCTCTTCCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026614.2-295s21c1
Sequence:CCGGACCAACGAGAAGCTGGATATGCTCGAGCATATCCAGCTTCTCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026614.2-349s21c1
Sequence:CCGGGCCTTGCTTCAGGGTGGTGAACTCGAGTTCACCACCCTGAAGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026614.2-318s21c1
Sequence:CCGGCAAGGCGGAGCCAGATGTTAACTCGAGTTAACATCTGGCTCCGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026614
VALIDATED
NDUFA5 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026614.2-204s21c1
Sequence:CCGGCGAGAGGCTCACAATATTGTACTCGAGTACAATATTGTGAGCCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-378s1c1
Sequence:CCGGAGGTGATTCTTCAGGCTGAAACTCGAGTTTCAGCCTGAAGAATCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-253s1c1
Sequence:CCGGCTTTCCTAAACATGCAGCCTACTCGAGTAGGCTGCATGTTTAGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-350s1c1
Sequence:CCGGGCCTTGCTTCAGGGTGGTGAACTCGAGTTCACCACCCTGAAGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-205s1c1
Sequence:CCGGCGAGAGGCTCACAATATTGTACTCGAGTACAATATTGTGAGCCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026614.1-368s1c1
Sequence:CCGGGAAGTGGAAGAGGTGATTCTTCTCGAGAAGAATCACCTCTTCCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026614.2-367s21c1
Sequence:CCGGGAAGTGGAAGAGGTGATTCTTCTCGAGAAGAATCACCTCTTCCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026614.2-295s21c1
Sequence:CCGGACCAACGAGAAGCTGGATATGCTCGAGCATATCCAGCTTCTCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026614.2-349s21c1
Sequence:CCGGGCCTTGCTTCAGGGTGGTGAACTCGAGTTCACCACCCTGAAGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026614.2-318s21c1
Sequence:CCGGCAAGGCGGAGCCAGATGTTAACTCGAGTTAACATCTGGCTCCGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)