EMAIL THIS PAGE TO A FRIEND

NDUFA6

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa

52 Gene Product Result for
Synonyms: B14 CI-B14 LYRM6 NADHB14
UniProtKB ID: P56556, B2RE54, O43675, Q6FGW0, Q6IBT8, Q6IC39
Gene ID:
Mouse(67130) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6 (B14)
Rat(315167) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6 (B14)
Zebrafish(393943) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6
cow(327670) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
domestic cat(101084209) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
dog(474483) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
chicken(427897) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
sheep(101114007) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
domestic guinea pig(100714209) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
naked mole-rat(101725381) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002490 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025987 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025987 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025987 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002490 Rosetta Predictions human pricing
NM_001130505 Rosetta Predictions rat pricing
NM_025987 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333932 predicted 284
2 SASI_Hs02_00333933 predicted 328
3 SASI_Hs02_00333934 predicted 939
4 SASI_Hs02_00333935 predicted 285
5 SASI_Hs02_00333936 predicted 262
6 SASI_Hs02_00333937 predicted 310
7 SASI_Hs02_00333938 predicted 317
8 SASI_Hs01_00131126 predicted 339
9 SASI_Hs02_00333939 predicted 233
10 SASI_Hs02_00333940 predicted 944
11 SASI_Hs01_00131117 predicted 369
12 SASI_Hs01_00131118 predicted 706
13 SASI_Hs01_00131119 predicted 488
14 SASI_Hs01_00131120 predicted 717
15 SASI_Hs01_00131121 predicted 611
16 SASI_Hs01_00131122 predicted 445
17 SASI_Hs01_00131123 predicted 584
18 SASI_Hs01_00131124 predicted 607
19 SASI_Hs01_00131125 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255479 predicted 248
2 SASI_Rn02_00255480 predicted 260
3 SASI_Rn02_00255481 predicted 248
4 SASI_Rn02_00255482 predicted 247
5 SASI_Rn02_00255483 predicted 211
6 SASI_Rn02_00255484 predicted 198
7 SASI_Rn02_00255485 predicted 208
8 SASI_Rn02_00255486 predicted 263
9 SASI_Rn02_00255487 predicted 194
10 SASI_Rn02_00255488 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054013 predicted 244
2 SASI_Mm01_00054014 predicted 202
3 SASI_Mm01_00054015 predicted 252
4 SASI_Mm01_00054016 predicted 208
5 SASI_Mm01_00054017 predicted 203
6 SASI_Mm01_00054018 predicted 207
7 SASI_Mm01_00054019 predicted 196
8 SASI_Mm01_00054020 predicted 215
9 SASI_Mm01_00054021 predicted 198
10 SASI_Mm01_00054022 predicted 197
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002490
VALIDATED
NDUFA6 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-373s21c1
Sequence:CCGGTGGTTGATCTTCTGGTCATTACTCGAGTAATGACCAGAAGATCAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-482s21c1
Sequence:CCGGGCCAAAGGATTTCCTATCCAACTCGAGTTGGATAGGAAATCCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-440s21c1
Sequence:CCGGGACACATGTTATGCGGTTCTTCTCGAGAAGAACCGCATAACATGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-329s21c1
Sequence:CCGGCCGAGAAATGTTTATGAAGAACTCGAGTTCTTCATAAACATTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-190s1c1
Sequence:CCGGCCGAGAAATGTTTATGAAGAACTCGAGTTCTTCATAAACATTTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-343s1c1
Sequence:CCGGGCCAAAGGATTTCCTATCCAACTCGAGTTGGATAGGAAATCCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-301s1c1
Sequence:CCGGGACACATGTTATGCGGTTCTTCTCGAGAAGAACCGCATAACATGTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-234s1c1
Sequence:CCGGTGGTTGATCTTCTGGTCATTACTCGAGTAATGACCAGAAGATCAACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002490.2-177s1c1
Sequence:CCGGGACGGGATAAAGTCCGAGAAACTCGAGTTTCTCGGACTTTATCCCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002490
VALIDATED
NDUFA6 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-373s21c1
Sequence:CCGGTGGTTGATCTTCTGGTCATTACTCGAGTAATGACCAGAAGATCAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-482s21c1
Sequence:CCGGGCCAAAGGATTTCCTATCCAACTCGAGTTGGATAGGAAATCCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-440s21c1
Sequence:CCGGGACACATGTTATGCGGTTCTTCTCGAGAAGAACCGCATAACATGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-329s21c1
Sequence:CCGGCCGAGAAATGTTTATGAAGAACTCGAGTTCTTCATAAACATTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-190s1c1
Sequence:CCGGCCGAGAAATGTTTATGAAGAACTCGAGTTCTTCATAAACATTTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-343s1c1
Sequence:CCGGGCCAAAGGATTTCCTATCCAACTCGAGTTGGATAGGAAATCCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-301s1c1
Sequence:CCGGGACACATGTTATGCGGTTCTTCTCGAGAAGAACCGCATAACATGTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-234s1c1
Sequence:CCGGTGGTTGATCTTCTGGTCATTACTCGAGTAATGACCAGAAGATCAACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002490.2-177s1c1
Sequence:CCGGGACGGGATAAAGTCCGAGAAACTCGAGTTTCTCGGACTTTATCCCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002490
VALIDATED
NDUFA6 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-373s21c1
Sequence:CCGGTGGTTGATCTTCTGGTCATTACTCGAGTAATGACCAGAAGATCAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-482s21c1
Sequence:CCGGGCCAAAGGATTTCCTATCCAACTCGAGTTGGATAGGAAATCCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-440s21c1
Sequence:CCGGGACACATGTTATGCGGTTCTTCTCGAGAAGAACCGCATAACATGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002490.3-329s21c1
Sequence:CCGGCCGAGAAATGTTTATGAAGAACTCGAGTTCTTCATAAACATTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-190s1c1
Sequence:CCGGCCGAGAAATGTTTATGAAGAACTCGAGTTCTTCATAAACATTTCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-343s1c1
Sequence:CCGGGCCAAAGGATTTCCTATCCAACTCGAGTTGGATAGGAAATCCTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-301s1c1
Sequence:CCGGGACACATGTTATGCGGTTCTTCTCGAGAAGAACCGCATAACATGTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002490.2-234s1c1
Sequence:CCGGTGGTTGATCTTCTGGTCATTACTCGAGTAATGACCAGAAGATCAACCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002490.2-177s1c1
Sequence:CCGGGACGGGATAAAGTCCGAGAAACTCGAGTTTCTCGGACTTTATCCCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025987
VALIDATED
NDUFA6 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-185s21c1
Sequence:CCGGCGGTGAAACAAGGACGGGATACTCGAGTATCCCGTCCTTGTTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-162s21c1
Sequence:CCGGGCACTTAATGCAGCTGGATATCTCGAGATATCCAGCTGCATTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-319s21c1
Sequence:CCGGCGGACACACGTTATGCGGTTTCTCGAGAAACCGCATAACGTGTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-264s21c1
Sequence:CCGGGCTGGTCATTAAGGGAAAGATCTCGAGATCTTTCCCTTAATGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-211s21c1
Sequence:CCGGCGAGAAATGTTCATGAAGAATCTCGAGATTCTTCATGAACATTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-185s1c1
Sequence:CCGGCGGTGAAACAAGGACGGGATACTCGAGTATCCCGTCCTTGTTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025987.1-319s1c1
Sequence:CCGGCGGACACACGTTATGCGGTTTCTCGAGAAACCGCATAACGTGTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-264s1c1
Sequence:CCGGGCTGGTCATTAAGGGAAAGATCTCGAGATCTTTCCCTTAATGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-211s1c1
Sequence:CCGGCGAGAAATGTTCATGAAGAATCTCGAGATTCTTCATGAACATTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-162s1c1
Sequence:CCGGGCACTTAATGCAGCTGGATATCTCGAGATATCCAGCTGCATTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025987
VALIDATED
NDUFA6 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-185s21c1
Sequence:CCGGCGGTGAAACAAGGACGGGATACTCGAGTATCCCGTCCTTGTTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-162s21c1
Sequence:CCGGGCACTTAATGCAGCTGGATATCTCGAGATATCCAGCTGCATTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-319s21c1
Sequence:CCGGCGGACACACGTTATGCGGTTTCTCGAGAAACCGCATAACGTGTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-264s21c1
Sequence:CCGGGCTGGTCATTAAGGGAAAGATCTCGAGATCTTTCCCTTAATGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-211s21c1
Sequence:CCGGCGAGAAATGTTCATGAAGAATCTCGAGATTCTTCATGAACATTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-185s1c1
Sequence:CCGGCGGTGAAACAAGGACGGGATACTCGAGTATCCCGTCCTTGTTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025987.1-319s1c1
Sequence:CCGGCGGACACACGTTATGCGGTTTCTCGAGAAACCGCATAACGTGTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-264s1c1
Sequence:CCGGGCTGGTCATTAAGGGAAAGATCTCGAGATCTTTCCCTTAATGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-211s1c1
Sequence:CCGGCGAGAAATGTTCATGAAGAATCTCGAGATTCTTCATGAACATTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-162s1c1
Sequence:CCGGGCACTTAATGCAGCTGGATATCTCGAGATATCCAGCTGCATTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025987
VALIDATED
NDUFA6 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-185s21c1
Sequence:CCGGCGGTGAAACAAGGACGGGATACTCGAGTATCCCGTCCTTGTTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-162s21c1
Sequence:CCGGGCACTTAATGCAGCTGGATATCTCGAGATATCCAGCTGCATTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-319s21c1
Sequence:CCGGCGGACACACGTTATGCGGTTTCTCGAGAAACCGCATAACGTGTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-264s21c1
Sequence:CCGGGCTGGTCATTAAGGGAAAGATCTCGAGATCTTTCCCTTAATGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025987.1-211s21c1
Sequence:CCGGCGAGAAATGTTCATGAAGAATCTCGAGATTCTTCATGAACATTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-185s1c1
Sequence:CCGGCGGTGAAACAAGGACGGGATACTCGAGTATCCCGTCCTTGTTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025987.1-319s1c1
Sequence:CCGGCGGACACACGTTATGCGGTTTCTCGAGAAACCGCATAACGTGTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-264s1c1
Sequence:CCGGGCTGGTCATTAAGGGAAAGATCTCGAGATCTTTCCCTTAATGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-211s1c1
Sequence:CCGGCGAGAAATGTTCATGAAGAATCTCGAGATTCTTCATGAACATTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025987.1-162s1c1
Sequence:CCGGGCACTTAATGCAGCTGGATATCTCGAGATATCCAGCTGCATTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)