EMAIL THIS PAGE TO A FRIEND

NDUFA7

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa

57 Gene Product Result for
Synonyms: B14.5a
UniProtKB ID: O95182
Gene ID:
Human(4701) Summary: This gene encodes a subunit of NADH:ubiquinone oxidoreductase (complex I), which is a multiprotein complex located in the inner mitochondrial membrane. Complex I functions in the transfer of electrons from NADH to the respiratory chain. [provided by RefSeq, Mar 2011]
Mouse(66416) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a)
Rat(299643) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7
Zebrafish(445042) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7
domestic cat(101091174) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
cow(338063) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
dog(476722) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
chicken(420065) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
naked mole-rat(101716235) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
domestic guinea pig(100732884) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
sheep(101103062) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023202 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023202 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023202 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005001 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005001 Rosetta Predictions human pricing
NM_001106772 Rosetta Predictions rat pricing
NM_023202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238735 predicted 233
2 SASI_Hs01_00238737 predicted 202
3 SASI_Hs01_00238738 predicted 249
4 SASI_Hs01_00238739 predicted 203
5 SASI_Hs01_00238736 predicted 195
6 SASI_Hs02_00338743 predicted 261
7 SASI_Hs02_00338744 predicted 262
8 SASI_Hs01_00238740 predicted 393
9 SASI_Hs01_00238741 predicted 115
10 SASI_Hs01_00238743 predicted 431
11 SASI_Hs01_00238742 predicted 174
12 SASI_Hs01_00238744 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222248 predicted 421
2 SASI_Rn02_00222249 predicted 378
3 SASI_Rn02_00222250 predicted 435
4 SASI_Rn02_00222251 predicted 512
5 SASI_Rn02_00222252 predicted 431
6 SASI_Rn02_00222253 predicted 505
7 SASI_Rn02_00222254 predicted 502
8 SASI_Rn02_00222255 predicted 510
9 SASI_Rn02_00222256 predicted 528
10 SASI_Rn02_00222257 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155647 predicted 204
2 SASI_Mm01_00155648 predicted 197
3 SASI_Mm01_00155649 predicted 256
4 SASI_Mm01_00155650 predicted 255
5 SASI_Mm01_00155651 predicted 213
6 SASI_Mm01_00155652 predicted 213
7 SASI_Mm01_00155653 predicted 256
8 SASI_Mm01_00155654 predicted 200
9 SASI_Mm01_00155655 predicted 247
10 SASI_Mm01_00155656 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023202
VALIDATED
NDUFA7 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-195s1c1
Sequence:CCGGGCCGGGAAGTTGTGCCTCCCTCTCGAGAGGGAGGCACAACTTCCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023202.2-162s1c1
Sequence:CCGGTGTCCAACAATTACTACTGTACTCGAGTACAGTAGTAATTGTTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-152s1c1
Sequence:CCGGAGTCACAAGCTGTCCAACAATCTCGAGATTGTTGGACAGCTTGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-212s1c1
Sequence:CCGGCCCTCAATCATCATGTCCTCACTCGAGTGAGGACATGATGATTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-329s1c1
Sequence:CCGGGAGCTGTCCAAGGACCAGCCACTCGAGTGGCTGGTCCTTGGACAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023202
VALIDATED
NDUFA7 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-195s1c1
Sequence:CCGGGCCGGGAAGTTGTGCCTCCCTCTCGAGAGGGAGGCACAACTTCCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023202.2-162s1c1
Sequence:CCGGTGTCCAACAATTACTACTGTACTCGAGTACAGTAGTAATTGTTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-152s1c1
Sequence:CCGGAGTCACAAGCTGTCCAACAATCTCGAGATTGTTGGACAGCTTGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-212s1c1
Sequence:CCGGCCCTCAATCATCATGTCCTCACTCGAGTGAGGACATGATGATTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-329s1c1
Sequence:CCGGGAGCTGTCCAAGGACCAGCCACTCGAGTGGCTGGTCCTTGGACAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023202
VALIDATED
NDUFA7 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-195s1c1
Sequence:CCGGGCCGGGAAGTTGTGCCTCCCTCTCGAGAGGGAGGCACAACTTCCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023202.2-162s1c1
Sequence:CCGGTGTCCAACAATTACTACTGTACTCGAGTACAGTAGTAATTGTTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-152s1c1
Sequence:CCGGAGTCACAAGCTGTCCAACAATCTCGAGATTGTTGGACAGCTTGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-212s1c1
Sequence:CCGGCCCTCAATCATCATGTCCTCACTCGAGTGAGGACATGATGATTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023202.2-329s1c1
Sequence:CCGGGAGCTGTCCAAGGACCAGCCACTCGAGTGGCTGGTCCTTGGACAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005001
VALIDATED
NDUFA7 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005001.1-174s1c1
Sequence:CCGGTCCAACAATTACTATTGCACTCTCGAGAGTGCAATAGTAATTGTTGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005001.1-164s1c1
Sequence:CCGGCCACAAGCTCTCCAACAATTACTCGAGTAATTGTTGGAGAGCTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005001.1-292s1c1
Sequence:CCGGCCACTGAGAAGAAGGCGGTGACTCGAGTCACCGCCTTCTTCTCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-123s21c1
Sequence:CCGGCAGGAGATCTCCAAGCGAACTCTCGAGAGTTCGCTTGGAGATCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-176s21c1
Sequence:CCGGCCACAAGCTCTCCAACAATTACTCGAGTAATTGTTGGAGAGCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-279s21c1
Sequence:CCGGCCAGCAGAGAGCTCTGCTGTACTCGAGTACAGCAGAGCTCTCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-304s21c1
Sequence:CCGGCCACTGAGAAGAAGGCGGTGACTCGAGTCACCGCCTTCTTCTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-239s21c1
Sequence:CCGGCATCATCATGTCGTCGCAGAACTCGAGTTCTGCGACGACATGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005001
VALIDATED
NDUFA7 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005001.1-174s1c1
Sequence:CCGGTCCAACAATTACTATTGCACTCTCGAGAGTGCAATAGTAATTGTTGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005001.1-164s1c1
Sequence:CCGGCCACAAGCTCTCCAACAATTACTCGAGTAATTGTTGGAGAGCTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005001.1-292s1c1
Sequence:CCGGCCACTGAGAAGAAGGCGGTGACTCGAGTCACCGCCTTCTTCTCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-123s21c1
Sequence:CCGGCAGGAGATCTCCAAGCGAACTCTCGAGAGTTCGCTTGGAGATCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-176s21c1
Sequence:CCGGCCACAAGCTCTCCAACAATTACTCGAGTAATTGTTGGAGAGCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-279s21c1
Sequence:CCGGCCAGCAGAGAGCTCTGCTGTACTCGAGTACAGCAGAGCTCTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-304s21c1
Sequence:CCGGCCACTGAGAAGAAGGCGGTGACTCGAGTCACCGCCTTCTTCTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-239s21c1
Sequence:CCGGCATCATCATGTCGTCGCAGAACTCGAGTTCTGCGACGACATGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005001
VALIDATED
NDUFA7 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005001.1-174s1c1
Sequence:CCGGTCCAACAATTACTATTGCACTCTCGAGAGTGCAATAGTAATTGTTGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005001.1-164s1c1
Sequence:CCGGCCACAAGCTCTCCAACAATTACTCGAGTAATTGTTGGAGAGCTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005001.1-292s1c1
Sequence:CCGGCCACTGAGAAGAAGGCGGTGACTCGAGTCACCGCCTTCTTCTCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-123s21c1
Sequence:CCGGCAGGAGATCTCCAAGCGAACTCTCGAGAGTTCGCTTGGAGATCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-176s21c1
Sequence:CCGGCCACAAGCTCTCCAACAATTACTCGAGTAATTGTTGGAGAGCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-279s21c1
Sequence:CCGGCCAGCAGAGAGCTCTGCTGTACTCGAGTACAGCAGAGCTCTCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-304s21c1
Sequence:CCGGCCACTGAGAAGAAGGCGGTGACTCGAGTCACCGCCTTCTTCTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005001.2-239s21c1
Sequence:CCGGCATCATCATGTCGTCGCAGAACTCGAGTTCTGCGACGACATGATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)