EMAIL THIS PAGE TO A FRIEND

NDUFA8

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa

56 Gene Product Result for
Synonyms: CI-19KD CI-PGIV PGIV
UniProtKB ID: P51970, B1AM93, Q9Y6N0
Gene ID:
Human(4702) Summary: The protein encoded by this gene belongs to the complex I 19 kDA subunit family. Mammalian complex I is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It plays an important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. [provided by RefSeq, Jul 2008]
Mouse(68375) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8
Rat(296658) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8
domestic guinea pig(100719139) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
naked mole-rat(101703248) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
sheep(101114253) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
Zebrafish(393700) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8
chicken(417112) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
cow(327710) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
domestic cat(101091412) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
dog(480741) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014222 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014222 Rosetta Predictions human pricing
NM_001047862 Rosetta Predictions rat pricing
NM_026703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200657 predicted 234
2 SASI_Hs01_00200658 predicted 336
3 SASI_Hs01_00200659 predicted 445
4 SASI_Hs01_00200660 predicted 539
5 SASI_Hs01_00200661 predicted 435
6 SASI_Hs01_00200663 predicted 392
7 SASI_Hs01_00200664 predicted 443
8 SASI_Hs01_00200665 predicted 442
9 SASI_Hs01_00200666 predicted 389
10 SASI_Hs02_00345251 predicted 553
11 SASI_Hs01_00200662 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206295 predicted 323
2 SASI_Rn02_00206296 predicted 325
3 SASI_Rn02_00206297 predicted 340
4 SASI_Rn02_00206298 predicted 363
5 SASI_Rn02_00206299 predicted 389
6 SASI_Rn02_00206300 predicted 376
7 SASI_Rn02_00206301 predicted 283
8 SASI_Rn02_00206302 predicted 203
9 SASI_Rn02_00206303 predicted 269
10 SASI_Rn02_00206304 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192698 predicted 279
2 SASI_Mm01_00192699 predicted 282
3 SASI_Mm01_00192700 predicted 275
4 SASI_Mm01_00192701 predicted 279
5 SASI_Mm01_00192702 predicted 197
6 SASI_Mm01_00192703 predicted 298
7 SASI_Mm01_00192704 predicted 234
8 SASI_Mm01_00192705 predicted 240
9 SASI_Mm01_00192706 predicted 245
10 SASI_Mm01_00192707 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026703
VALIDATED
NDUFA8 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-419s21c1
Sequence:CCGGGCAGTTGTCTAAGGTCACCAACTCGAGTTGGTGACCTTAGACAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-314s21c1
Sequence:CCGGCCTTGATTACTCCAACATGCACTCGAGTGCATGTTGGAGTAATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-254s21c1
Sequence:CCGGGAACTTCTTCAGGCAGATAAACTCGAGTTTATCTGCCTGAAGAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-302s21c1
Sequence:CCGGGTACTGGACTTGCCTTGATTACTCGAGTAATCAAGGCAAGTCCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026703.1-419s1c1
Sequence:CCGGGCAGTTGTCTAAGGTCACCAACTCGAGTTGGTGACCTTAGACAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026703.1-302s1c1
Sequence:CCGGGTACTGGACTTGCCTTGATTACTCGAGTAATCAAGGCAAGTCCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026703.1-254s1c1
Sequence:CCGGGAACTTCTTCAGGCAGATAAACTCGAGTTTATCTGCCTGAAGAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026703.1-314s1c1
Sequence:CCGGCCTTGATTACTCCAACATGCACTCGAGTGCATGTTGGAGTAATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026703
VALIDATED
NDUFA8 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-419s21c1
Sequence:CCGGGCAGTTGTCTAAGGTCACCAACTCGAGTTGGTGACCTTAGACAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-314s21c1
Sequence:CCGGCCTTGATTACTCCAACATGCACTCGAGTGCATGTTGGAGTAATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-254s21c1
Sequence:CCGGGAACTTCTTCAGGCAGATAAACTCGAGTTTATCTGCCTGAAGAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-302s21c1
Sequence:CCGGGTACTGGACTTGCCTTGATTACTCGAGTAATCAAGGCAAGTCCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026703.1-419s1c1
Sequence:CCGGGCAGTTGTCTAAGGTCACCAACTCGAGTTGGTGACCTTAGACAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026703.1-302s1c1
Sequence:CCGGGTACTGGACTTGCCTTGATTACTCGAGTAATCAAGGCAAGTCCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026703.1-254s1c1
Sequence:CCGGGAACTTCTTCAGGCAGATAAACTCGAGTTTATCTGCCTGAAGAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026703.1-314s1c1
Sequence:CCGGCCTTGATTACTCCAACATGCACTCGAGTGCATGTTGGAGTAATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026703
VALIDATED
NDUFA8 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-419s21c1
Sequence:CCGGGCAGTTGTCTAAGGTCACCAACTCGAGTTGGTGACCTTAGACAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-314s21c1
Sequence:CCGGCCTTGATTACTCCAACATGCACTCGAGTGCATGTTGGAGTAATCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-254s21c1
Sequence:CCGGGAACTTCTTCAGGCAGATAAACTCGAGTTTATCTGCCTGAAGAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026703.2-302s21c1
Sequence:CCGGGTACTGGACTTGCCTTGATTACTCGAGTAATCAAGGCAAGTCCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026703.1-419s1c1
Sequence:CCGGGCAGTTGTCTAAGGTCACCAACTCGAGTTGGTGACCTTAGACAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026703.1-302s1c1
Sequence:CCGGGTACTGGACTTGCCTTGATTACTCGAGTAATCAAGGCAAGTCCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026703.1-254s1c1
Sequence:CCGGGAACTTCTTCAGGCAGATAAACTCGAGTTTATCTGCCTGAAGAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026703.1-314s1c1
Sequence:CCGGCCTTGATTACTCCAACATGCACTCGAGTGCATGTTGGAGTAATCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014222
VALIDATED
NDUFA8 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014222.2-396s21c1
Sequence:CCGGATTGGACTTGCATTGATTATACTCGAGTATAATCAATGCAAGTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014222.2-543s21c1
Sequence:CCGGATCGACCTTTACCGGAGAATCCTCGAGGATTCTCCGGTAAAGGTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014222.2-683s21c1
Sequence:CCGGTCGGTCATGTGCTCAGACAACCTCGAGGTTGTCTGAGCACATGACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014222.2-465s21c1
Sequence:CCGGACGAGTGTGTGCTGGACAAACCTCGAGGTTTGTCCAGCACACACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014222.2-253s21c1
Sequence:CCGGTAAGCCCAACAAGGAGTTTATCTCGAGATAAACTCCTTGTTGGGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014222.2-305s1c1
Sequence:CCGGCGGTGTTTAGAGGAAGGCAAACTCGAGTTTGCCTTCCTCTAAACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014222.2-244s1c1
Sequence:CCGGTCAATGTGATAAGCCCAACAACTCGAGTTGTTGGGCTTATCACATTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014222.2-443s1c1
Sequence:CCGGCGCAAACAGCAGGCAAAGTTTCTCGAGAAACTTTGCCTGCTGTTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014222.2-542s1c1
Sequence:CCGGGATCGACCTTTACCGGAGAATCTCGAGATTCTCCGGTAAAGGTCGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014222.2-228s1c1
Sequence:CCGGCCCATCACTATGGAGCTCAATCTCGAGATTGAGCTCCATAGTGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014222
VALIDATED
NDUFA8 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014222.2-396s21c1
Sequence:CCGGATTGGACTTGCATTGATTATACTCGAGTATAATCAATGCAAGTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014222.2-543s21c1
Sequence:CCGGATCGACCTTTACCGGAGAATCCTCGAGGATTCTCCGGTAAAGGTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014222.2-683s21c1
Sequence:CCGGTCGGTCATGTGCTCAGACAACCTCGAGGTTGTCTGAGCACATGACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014222.2-465s21c1
Sequence:CCGGACGAGTGTGTGCTGGACAAACCTCGAGGTTTGTCCAGCACACACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014222.2-253s21c1
Sequence:CCGGTAAGCCCAACAAGGAGTTTATCTCGAGATAAACTCCTTGTTGGGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014222.2-305s1c1
Sequence:CCGGCGGTGTTTAGAGGAAGGCAAACTCGAGTTTGCCTTCCTCTAAACACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014222.2-244s1c1
Sequence:CCGGTCAATGTGATAAGCCCAACAACTCGAGTTGTTGGGCTTATCACATTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014222.2-443s1c1
Sequence:CCGGCGCAAACAGCAGGCAAAGTTTCTCGAGAAACTTTGCCTGCTGTTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014222.2-542s1c1
Sequence:CCGGGATCGACCTTTACCGGAGAATCTCGAGATTCTCCGGTAAAGGTCGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014222.2-228s1c1
Sequence:CCGGCCCATCACTATGGAGCTCAATCTCGAGATTGAGCTCCATAGTGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014222
VALIDATED
NDUFA8 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014222.2-396s21c1
Sequence:CCGGATTGGACTTGCATTGATTATACTCGAGTATAATCAATGCAAGTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014222.2-543s21c1
Sequence:CCGGATCGACCTTTACCGGAGAATCCTCGAGGATTCTCCGGTAAAGGTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014222.2-683s21c1
Sequence:CCGGTCGGTCATGTGCTCAGACAACCTCGAGGTTGTCTGAGCACATGACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014222.2-465s21c1
Sequence:CCGGACGAGTGTGTGCTGGACAAACCTCGAGGTTTGTCCAGCACACACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014222.2-253s21c1
Sequence:CCGGTAAGCCCAACAAGGAGTTTATCTCGAGATAAACTCCTTGTTGGGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014222.2-305s1c1
Sequence:CCGGCGGTGTTTAGAGGAAGGCAAACTCGAGTTTGCCTTCCTCTAAACACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014222.2-244s1c1
Sequence:CCGGTCAATGTGATAAGCCCAACAACTCGAGTTGTTGGGCTTATCACATTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014222.2-443s1c1
Sequence:CCGGCGCAAACAGCAGGCAAAGTTTCTCGAGAAACTTTGCCTGCTGTTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014222.2-542s1c1
Sequence:CCGGGATCGACCTTTACCGGAGAATCTCGAGATTCTCCGGTAAAGGTCGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014222.2-228s1c1
Sequence:CCGGCCCATCACTATGGAGCTCAATCTCGAGATTGAGCTCCATAGTGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)