EMAIL THIS PAGE TO A FRIEND

NDUFA9

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa

62 Gene Product Result for
Synonyms: CC6 CI-39k CI39k NDUFS2L SDR22E1
UniProtKB ID: Q16795, Q14076, Q2NKX0
Gene ID:
Human(4704) Summary: The encoded protein is a subunit of the hydrophobic protein fraction of the NADH:ubiquinone oxidoreductase (complex I), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane. A pseudogene has been identified on chromosome 12. [provided by RefSeq, May 2010]
Mouse(66108) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9
Rat(362440) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9
Zebrafish(541331) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9
chicken(419039) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
cow(404188) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
domestic cat(101092862) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
dog(477718) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
sheep(101115781) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
naked mole-rat(101725535) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
domestic guinea pig(100731702) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005002 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU032821 MISSION® esiRNA esiRNA targeting mouse Ndufa9 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005002 Rosetta Predictions human pricing
NM_001100752 Rosetta Predictions rat pricing
NM_025358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338745 predicted 925
2 SASI_Hs01_00173808 predicted 974
3 SASI_Hs02_00338746 predicted 633
4 SASI_Hs01_00173810 predicted 507
5 SASI_Hs02_00338747 predicted 925
6 SASI_Hs02_00338748 predicted 563
7 SASI_Hs01_00173811 predicted 578
8 SASI_Hs01_00173812 predicted 897
9 SASI_Hs02_00338749 predicted 585
10 SASI_Hs02_00338750 predicted 581
11 SASI_Hs01_00173806 predicted 1013
12 SASI_Hs01_00173807 predicted 952
13 SASI_Hs01_00173809 predicted 910
14 SASI_Hs01_00173813 predicted 384
15 SASI_Hs01_00173814 predicted 597
16 SASI_Hs01_00173815 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210468 predicted 252
2 SASI_Rn02_00210469 predicted 448
3 SASI_Rn02_00210470 predicted 749
4 SASI_Rn02_00210471 predicted 254
5 SASI_Rn02_00210472 predicted 509
6 SASI_Rn02_00210473 predicted 308
7 SASI_Rn02_00210474 predicted 735
8 SASI_Rn02_00210475 predicted 237
9 SASI_Rn02_00210476 predicted 723
10 SASI_Rn02_00210477 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040240 predicted 892
2 SASI_Mm01_00040241 predicted 526
3 SASI_Mm01_00040242 predicted 443
4 SASI_Mm02_00328046 predicted 343
5 SASI_Mm01_00040243 predicted 252
6 SASI_Mm01_00040244 predicted 252
7 SASI_Mm01_00040245 predicted 342
8 SASI_Mm01_00040246 predicted 202
9 SASI_Mm02_00328047 predicted 725
10 SASI_Mm01_00040247 predicted 715
11 SASI_Mm01_00040248 predicted 974
12 SASI_Mm01_00040249 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025358
VALIDATED
NDUFA9 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-882s1c1
Sequence:CCGGCCTTACCCTTTGCCACTATTTCTCGAGAAATAGTGGCAAAGGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-693s1c1
Sequence:CCGGCCTCTTGTTTCTTTGGGCTTTCTCGAGAAAGCCCAAAGAAACAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-730s1c1
Sequence:CCGGCGGTGTATGTTGCAGATGTTTCTCGAGAAACATCTGCAACATACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-316s1c1
Sequence:CCGGGCCAGCTTACCTTTCTGGAATCTCGAGATTCCAGAAAGGTAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-206s1c1
Sequence:CCGGCCTGGGTCGATACGTTGTTAACTCGAGTTAACAACGTATCGACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-692s21c1
Sequence:CCGGCCTCTTGTTTCTTTGGGCTTTCTCGAGAAAGCCCAAAGAAACAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-205s21c1
Sequence:CCGGCCTGGGTCGATACGTTGTTAACTCGAGTTAACAACGTATCGACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-881s21c1
Sequence:CCGGCCTTACCCTTTGCCACTATTTCTCGAGAAATAGTGGCAAAGGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-315s21c1
Sequence:CCGGGCCAGCTTACCTTTCTGGAATCTCGAGATTCCAGAAAGGTAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025358
VALIDATED
NDUFA9 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-882s1c1
Sequence:CCGGCCTTACCCTTTGCCACTATTTCTCGAGAAATAGTGGCAAAGGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-693s1c1
Sequence:CCGGCCTCTTGTTTCTTTGGGCTTTCTCGAGAAAGCCCAAAGAAACAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-730s1c1
Sequence:CCGGCGGTGTATGTTGCAGATGTTTCTCGAGAAACATCTGCAACATACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-316s1c1
Sequence:CCGGGCCAGCTTACCTTTCTGGAATCTCGAGATTCCAGAAAGGTAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-206s1c1
Sequence:CCGGCCTGGGTCGATACGTTGTTAACTCGAGTTAACAACGTATCGACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-692s21c1
Sequence:CCGGCCTCTTGTTTCTTTGGGCTTTCTCGAGAAAGCCCAAAGAAACAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-205s21c1
Sequence:CCGGCCTGGGTCGATACGTTGTTAACTCGAGTTAACAACGTATCGACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-881s21c1
Sequence:CCGGCCTTACCCTTTGCCACTATTTCTCGAGAAATAGTGGCAAAGGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-315s21c1
Sequence:CCGGGCCAGCTTACCTTTCTGGAATCTCGAGATTCCAGAAAGGTAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025358
VALIDATED
NDUFA9 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-882s1c1
Sequence:CCGGCCTTACCCTTTGCCACTATTTCTCGAGAAATAGTGGCAAAGGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-693s1c1
Sequence:CCGGCCTCTTGTTTCTTTGGGCTTTCTCGAGAAAGCCCAAAGAAACAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-730s1c1
Sequence:CCGGCGGTGTATGTTGCAGATGTTTCTCGAGAAACATCTGCAACATACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-316s1c1
Sequence:CCGGGCCAGCTTACCTTTCTGGAATCTCGAGATTCCAGAAAGGTAAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025358.1-206s1c1
Sequence:CCGGCCTGGGTCGATACGTTGTTAACTCGAGTTAACAACGTATCGACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-692s21c1
Sequence:CCGGCCTCTTGTTTCTTTGGGCTTTCTCGAGAAAGCCCAAAGAAACAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-205s21c1
Sequence:CCGGCCTGGGTCGATACGTTGTTAACTCGAGTTAACAACGTATCGACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-881s21c1
Sequence:CCGGCCTTACCCTTTGCCACTATTTCTCGAGAAATAGTGGCAAAGGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025358.2-315s21c1
Sequence:CCGGGCCAGCTTACCTTTCTGGAATCTCGAGATTCCAGAAAGGTAAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005002
VALIDATED
NDUFA9 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005002.3-337s1c1
Sequence:CCGGCGCGAGAGATAAAGATTCTATCTCGAGATAGAATCTTTATCTCTCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_005002.3-725s1c1
Sequence:CCGGCCAGTATATGTCGTAGATGTACTCGAGTACATCTACGACATATACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005002.3-862s1c1
Sequence:CCGGTCACAGATTGTTCCTCCCATTCTCGAGAATGGGAGGAACAATCTGTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005002.3-943s1c1
Sequence:CCGGGCCCTGGATAACAAGGGATAACTCGAGTTATCCCTTGTTATCCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_005002.3-362s1c1
Sequence:CCGGCGAGTAGTACAACACAGCAATCTCGAGATTGCTGTGTTGTACTACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-725s21c1
Sequence:CCGGCCAGTATATGTCGTAGATGTACTCGAGTACATCTACGACATATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-943s21c1
Sequence:CCGGGCCCTGGATAACAAGGGATAACTCGAGTTATCCCTTGTTATCCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-337s21c1
Sequence:CCGGCGCGAGAGATAAAGATTCTATCTCGAGATAGAATCTTTATCTCTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-362s21c1
Sequence:CCGGCGAGTAGTACAACACAGCAATCTCGAGATTGCTGTGTTGTACTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005002
VALIDATED
NDUFA9 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005002.3-337s1c1
Sequence:CCGGCGCGAGAGATAAAGATTCTATCTCGAGATAGAATCTTTATCTCTCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_005002.3-725s1c1
Sequence:CCGGCCAGTATATGTCGTAGATGTACTCGAGTACATCTACGACATATACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005002.3-862s1c1
Sequence:CCGGTCACAGATTGTTCCTCCCATTCTCGAGAATGGGAGGAACAATCTGTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005002.3-943s1c1
Sequence:CCGGGCCCTGGATAACAAGGGATAACTCGAGTTATCCCTTGTTATCCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_005002.3-362s1c1
Sequence:CCGGCGAGTAGTACAACACAGCAATCTCGAGATTGCTGTGTTGTACTACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-725s21c1
Sequence:CCGGCCAGTATATGTCGTAGATGTACTCGAGTACATCTACGACATATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-943s21c1
Sequence:CCGGGCCCTGGATAACAAGGGATAACTCGAGTTATCCCTTGTTATCCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-337s21c1
Sequence:CCGGCGCGAGAGATAAAGATTCTATCTCGAGATAGAATCTTTATCTCTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-362s21c1
Sequence:CCGGCGAGTAGTACAACACAGCAATCTCGAGATTGCTGTGTTGTACTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005002
VALIDATED
NDUFA9 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005002.3-337s1c1
Sequence:CCGGCGCGAGAGATAAAGATTCTATCTCGAGATAGAATCTTTATCTCTCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_005002.3-725s1c1
Sequence:CCGGCCAGTATATGTCGTAGATGTACTCGAGTACATCTACGACATATACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005002.3-862s1c1
Sequence:CCGGTCACAGATTGTTCCTCCCATTCTCGAGAATGGGAGGAACAATCTGTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005002.3-943s1c1
Sequence:CCGGGCCCTGGATAACAAGGGATAACTCGAGTTATCCCTTGTTATCCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_005002.3-362s1c1
Sequence:CCGGCGAGTAGTACAACACAGCAATCTCGAGATTGCTGTGTTGTACTACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-725s21c1
Sequence:CCGGCCAGTATATGTCGTAGATGTACTCGAGTACATCTACGACATATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-943s21c1
Sequence:CCGGGCCCTGGATAACAAGGGATAACTCGAGTTATCCCTTGTTATCCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-337s21c1
Sequence:CCGGCGCGAGAGATAAAGATTCTATCTCGAGATAGAATCTTTATCTCTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005002.3-362s21c1
Sequence:CCGGCGAGTAGTACAACACAGCAATCTCGAGATTGCTGTGTTGTACTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)