EMAIL THIS PAGE TO A FRIEND

NDUFAF1

NADH dehydrogenase (ubiquinone) complex I, assembly factor 1

53 Gene Product Result for
Synonyms: CGI65 CIA30
UniProtKB ID: Q9Y375, Q9BVZ5
Gene ID:
Human(51103) Summary: This gene encodes a complex I assembly factor protein. Complex I (NADH-ubiquinone oxidoreductase) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. The encoded protein is required for assembly of complex I, and mutations in this gene are a cause of mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Dec 2011]
Mouse(69702) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1
Rat(296086) NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
Zebrafish(503714) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1
chicken(423214) NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
dog(487505) NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
domestic cat(101085215) NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
cow(541232) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1
sheep(101113336) NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
naked mole-rat(101724974) NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
domestic guinea pig(100732600) NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016013 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016013 Rosetta Predictions human pricing
NM_001106500 Rosetta Predictions rat pricing
NM_027175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097628 predicted 631
2 SASI_Hs02_00348692 predicted 641
3 SASI_Hs02_00348693 predicted 629
4 SASI_Hs01_00097632 predicted 598
5 SASI_Hs01_00097633 predicted 1194
6 SASI_Hs02_00348694 predicted 979
7 SASI_Hs01_00097635 predicted 603
8 SASI_Hs02_00348695 predicted 1030
9 SASI_Hs01_00097637 predicted 1182
10 SASI_Hs02_00348696 predicted 1052
11 SASI_Hs01_00097629 predicted 1210
12 SASI_Hs01_00097630 predicted 1226
13 SASI_Hs01_00097631 predicted 721
14 SASI_Hs01_00097634 predicted 988
15 SASI_Hs01_00097636 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219578 predicted 473
2 SASI_Rn02_00219579 predicted 1124
3 SASI_Rn02_00219580 predicted 609
4 SASI_Rn02_00219581 predicted 762
5 SASI_Rn02_00219582 predicted 717
6 SASI_Rn02_00219583 predicted 719
7 SASI_Rn02_00219584 predicted 1199
8 SASI_Rn02_00219585 predicted 976
9 SASI_Rn02_00219586 predicted 565
10 SASI_Rn02_00219587 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042325 predicted 339
2 SASI_Mm02_00331688 predicted 563
3 SASI_Mm01_00042326 predicted 266
4 SASI_Mm01_00042328 predicted 1100
5 SASI_Mm01_00042329 predicted 755
6 SASI_Mm01_00042330 predicted 606
7 SASI_Mm01_00042331 predicted 436
8 SASI_Mm01_00042332 predicted 707
9 SASI_Mm01_00042334 predicted 550
10 SASI_Mm02_00331689 predicted 870
11 SASI_Mm01_00042327 predicted 1127
12 SASI_Mm01_00042333 predicted 977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027175
VALIDATED
NDUFAF1 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027175.2-1092s1c1
Sequence:CCGGCCCACTCGTATTGGACAAGATCTCGAGATCTTGTCCAATACGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-607s1c1
Sequence:CCGGCGCCCATTACAAGAGGTCATACTCGAGTATGACCTCTTGTAATGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-368s1c1
Sequence:CCGGGTGTAGACTATTCTTCCAGTACTCGAGTACTGGAAGAATAGTCTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-1199s1c1
Sequence:CCGGCCCATACAGAAGAATTTGCTTCTCGAGAAGCAAATTCTTCTGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-954s1c1
Sequence:CCGGCACGGAGTTTATCCAGAGAAACTCGAGTTTCTCTGGATAAACTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-922s21c1
Sequence:CCGGGACGGCCTTGGATGGTAAATACTCGAGTATTTACCATCCAAGGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-1273s21c1
Sequence:CCGGTCAGTAGAGTAGTGGTCACAACTCGAGTTGTGACCACTACTCTACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-953s21c1
Sequence:CCGGCACGGAGTTTATCCAGAGAAACTCGAGTTTCTCTGGATAAACTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-367s21c1
Sequence:CCGGGTGTAGACTATTCTTCCAGTACTCGAGTACTGGAAGAATAGTCTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-1198s21c1
Sequence:CCGGCCCATACAGAAGAATTTGCTTCTCGAGAAGCAAATTCTTCTGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027175
VALIDATED
NDUFAF1 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027175.2-1092s1c1
Sequence:CCGGCCCACTCGTATTGGACAAGATCTCGAGATCTTGTCCAATACGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-607s1c1
Sequence:CCGGCGCCCATTACAAGAGGTCATACTCGAGTATGACCTCTTGTAATGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-368s1c1
Sequence:CCGGGTGTAGACTATTCTTCCAGTACTCGAGTACTGGAAGAATAGTCTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-1199s1c1
Sequence:CCGGCCCATACAGAAGAATTTGCTTCTCGAGAAGCAAATTCTTCTGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-954s1c1
Sequence:CCGGCACGGAGTTTATCCAGAGAAACTCGAGTTTCTCTGGATAAACTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-922s21c1
Sequence:CCGGGACGGCCTTGGATGGTAAATACTCGAGTATTTACCATCCAAGGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-1273s21c1
Sequence:CCGGTCAGTAGAGTAGTGGTCACAACTCGAGTTGTGACCACTACTCTACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-953s21c1
Sequence:CCGGCACGGAGTTTATCCAGAGAAACTCGAGTTTCTCTGGATAAACTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-367s21c1
Sequence:CCGGGTGTAGACTATTCTTCCAGTACTCGAGTACTGGAAGAATAGTCTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-1198s21c1
Sequence:CCGGCCCATACAGAAGAATTTGCTTCTCGAGAAGCAAATTCTTCTGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027175
VALIDATED
NDUFAF1 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027175.2-1092s1c1
Sequence:CCGGCCCACTCGTATTGGACAAGATCTCGAGATCTTGTCCAATACGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-607s1c1
Sequence:CCGGCGCCCATTACAAGAGGTCATACTCGAGTATGACCTCTTGTAATGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-368s1c1
Sequence:CCGGGTGTAGACTATTCTTCCAGTACTCGAGTACTGGAAGAATAGTCTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-1199s1c1
Sequence:CCGGCCCATACAGAAGAATTTGCTTCTCGAGAAGCAAATTCTTCTGTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027175.2-954s1c1
Sequence:CCGGCACGGAGTTTATCCAGAGAAACTCGAGTTTCTCTGGATAAACTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-922s21c1
Sequence:CCGGGACGGCCTTGGATGGTAAATACTCGAGTATTTACCATCCAAGGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-1273s21c1
Sequence:CCGGTCAGTAGAGTAGTGGTCACAACTCGAGTTGTGACCACTACTCTACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-953s21c1
Sequence:CCGGCACGGAGTTTATCCAGAGAAACTCGAGTTTCTCTGGATAAACTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-367s21c1
Sequence:CCGGGTGTAGACTATTCTTCCAGTACTCGAGTACTGGAAGAATAGTCTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027175.3-1198s21c1
Sequence:CCGGCCCATACAGAAGAATTTGCTTCTCGAGAAGCAAATTCTTCTGTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016013
VALIDATED
NDUFAF1 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-458s1c1
Sequence:CCGGGCAGAGTATTCCAGTAGTCTTCTCGAGAAGACTACTGGAATACTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016013.2-855s21c1
Sequence:CCGGACCAAAGTGCACTGCTATATGCTCGAGCATATAGCAGTGCACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-614s1c1
Sequence:CCGGGCAATTAGAGATGAAGCAATACTCGAGTATTGCTTCATCTCTAATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-1280s1c1
Sequence:CCGGCCAGCTCATACAGAAGAATTTCTCGAGAAATTCTTCTGTATGAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-1108s1c1
Sequence:CCGGGCAGGAGGTCAAGATTCCTTTCTCGAGAAAGGAATCTTGACCTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016013.1-1185s1c1
Sequence:CCGGCGCTTGATAAGATCTCTTCTACTCGAGTAGAAGAGATCTTATCAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016013.2-635s21c1
Sequence:CCGGGCAATTAGAGATGAAGCAATACTCGAGTATTGCTTCATCTCTAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016013.2-1301s21c1
Sequence:CCGGCCAGCTCATACAGAAGAATTTCTCGAGAAATTCTTCTGTATGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016013.2-479s21c1
Sequence:CCGGGCAGAGTATTCCAGTAGTCTTCTCGAGAAGACTACTGGAATACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016013
VALIDATED
NDUFAF1 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-458s1c1
Sequence:CCGGGCAGAGTATTCCAGTAGTCTTCTCGAGAAGACTACTGGAATACTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016013.2-855s21c1
Sequence:CCGGACCAAAGTGCACTGCTATATGCTCGAGCATATAGCAGTGCACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-614s1c1
Sequence:CCGGGCAATTAGAGATGAAGCAATACTCGAGTATTGCTTCATCTCTAATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-1280s1c1
Sequence:CCGGCCAGCTCATACAGAAGAATTTCTCGAGAAATTCTTCTGTATGAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-1108s1c1
Sequence:CCGGGCAGGAGGTCAAGATTCCTTTCTCGAGAAAGGAATCTTGACCTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016013.1-1185s1c1
Sequence:CCGGCGCTTGATAAGATCTCTTCTACTCGAGTAGAAGAGATCTTATCAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016013.2-635s21c1
Sequence:CCGGGCAATTAGAGATGAAGCAATACTCGAGTATTGCTTCATCTCTAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016013.2-1301s21c1
Sequence:CCGGCCAGCTCATACAGAAGAATTTCTCGAGAAATTCTTCTGTATGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016013.2-479s21c1
Sequence:CCGGGCAGAGTATTCCAGTAGTCTTCTCGAGAAGACTACTGGAATACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016013
VALIDATED
NDUFAF1 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-458s1c1
Sequence:CCGGGCAGAGTATTCCAGTAGTCTTCTCGAGAAGACTACTGGAATACTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016013.2-855s21c1
Sequence:CCGGACCAAAGTGCACTGCTATATGCTCGAGCATATAGCAGTGCACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-614s1c1
Sequence:CCGGGCAATTAGAGATGAAGCAATACTCGAGTATTGCTTCATCTCTAATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-1280s1c1
Sequence:CCGGCCAGCTCATACAGAAGAATTTCTCGAGAAATTCTTCTGTATGAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016013.1-1108s1c1
Sequence:CCGGGCAGGAGGTCAAGATTCCTTTCTCGAGAAAGGAATCTTGACCTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016013.1-1185s1c1
Sequence:CCGGCGCTTGATAAGATCTCTTCTACTCGAGTAGAAGAGATCTTATCAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016013.2-635s21c1
Sequence:CCGGGCAATTAGAGATGAAGCAATACTCGAGTATTGCTTCATCTCTAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016013.2-1301s21c1
Sequence:CCGGCCAGCTCATACAGAAGAATTTCTCGAGAAATTCTTCTGTATGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016013.2-479s21c1
Sequence:CCGGGCAGAGTATTCCAGTAGTCTTCTCGAGAAGACTACTGGAATACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)