EMAIL THIS PAGE TO A FRIEND

NDUFAF2

NADH dehydrogenase (ubiquinone) complex I, assembly factor 2

111 Gene Product Result for
Synonyms: B17.2L MMTN NDUFA12L mimitin
UniProtKB ID: Q8N183, A8K5I1
Gene ID:
Human(91942) Summary: NADH:ubiquinone oxidoreductase (complex I) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. This gene encodes a complex I assembly factor. Mutations in this gene cause progressive encephalopathy resulting from mitochondrial complex I deficiency. [provided by RefSeq, Jul 2008]
Mouse(75597) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2
Rat(361894) NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
domestic guinea pig(100720300) NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
naked mole-rat(101724515) NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
sheep(101107993) NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
Zebrafish(100003850) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2
chicken(769549) NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
dog(478067) NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
cow(767961) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2
domestic cat(101100614) NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174889 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001127346 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001127346 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001127346 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174889 Rosetta Predictions human pricing
XM_001073799 Rosetta Predictions rat pricing
XM_342191 Rosetta Predictions rat pricing
NM_001127346 Rosetta Predictions mouse pricing
XM_001002342 Rosetta Predictions mouse pricing
XM_001002350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368750 predicted 196
2 SASI_Hs02_00368751 predicted 200
3 SASI_Hs01_00102511 predicted 367
4 SASI_Hs02_00368752 predicted 249
5 SASI_Hs01_00102517 predicted 325
6 SASI_Hs02_00368753 predicted 248
7 SASI_Hs02_00368754 predicted 245
8 SASI_Hs02_00368755 predicted 204
9 SASI_Hs02_00368756 predicted 370
10 SASI_Hs02_00368757 predicted 368
11 SASI_Hs01_00102510 predicted 293
12 SASI_Hs01_00102512 predicted 282
13 SASI_Hs01_00102513 predicted 406
14 SASI_Hs01_00102514 predicted 253
15 SASI_Hs01_00102515 predicted 300
16 SASI_Hs01_00102516 predicted 274
17 SASI_Hs01_00102518 predicted 299
18 SASI_Hs01_00102519 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343984 predicted 240
2 SASI_Rn02_00343985 predicted 268
3 SASI_Rn02_00343986 predicted 203
4 SASI_Rn02_00343987 predicted 236
5 SASI_Rn02_00343988 predicted 269
6 SASI_Rn02_00343989 predicted 271
7 SASI_Rn02_00343990 predicted 227
8 SASI_Rn02_00343991 predicted 275
9 SASI_Rn02_00343992 predicted 279
10 SASI_Rn02_00343993 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177302 predicted 234
2 SASI_Rn01_00177303 predicted 272
3 SASI_Rn02_00393883 predicted 204
4 SASI_Rn01_00177307 predicted 236
5 SASI_Rn01_00177308 predicted 270
6 SASI_Rn02_00393884 predicted 264
7 SASI_Rn01_00177309 predicted 225
8 SASI_Rn02_00393885 predicted 283
9 SASI_Rn01_00177310 predicted 275
10 SASI_Rn01_00177311 predicted 277
11 SASI_Rn01_00177304 predicted 304
12 SASI_Rn01_00177305 predicted 289
13 SASI_Rn01_00177306 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310267 predicted 303
2 SASI_Mm02_00310268 predicted 223
3 SASI_Mm02_00310269 predicted 291
4 SASI_Mm02_00310270 predicted 296
5 SASI_Mm02_00310271 predicted 268
6 SASI_Mm02_00310272 predicted 258
7 SASI_Mm02_00310273 predicted 274
8 SASI_Mm02_00310274 predicted 302
9 SASI_Mm02_00310275 predicted 301
10 SASI_Mm02_00310276 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002342 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259738 predicted 295
2 SASI_Mm01_00259739 predicted 245
3 SASI_Mm01_00259740 predicted 275
4 SASI_Mm01_00259741 predicted 307
5 SASI_Mm01_00259742 predicted 242
6 SASI_Mm01_00259743 predicted 325
7 SASI_Mm01_00259744 predicted 240
8 SASI_Mm01_00259745 predicted 132
9 SASI_Mm01_00259746 predicted 336
10 SASI_Mm01_00259747 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227119 predicted 306
2 SASI_Mm01_00227120 predicted 332
3 SASI_Mm01_00227121 predicted 306
4 SASI_Mm01_00227122 predicted 272
5 SASI_Mm01_00227123 predicted 304
6 SASI_Mm01_00227124 predicted 264
7 SASI_Mm01_00227125 predicted 274
8 SASI_Mm01_00227126 predicted 307
9 SASI_Mm01_00227127 predicted 306
10 SASI_Mm01_00227128 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174889
VALIDATED
NDUFAF2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-522s21c1
Sequence:CCGGATGCCTCTGCTCCATACTTTGCTCGAGCAAAGTATGGAGCAGAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-201s21c1
Sequence:CCGGCGGACCAATTCGGGAACAAATCTCGAGATTTGTTCCCGAATTGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-491s21c1
Sequence:CCGGCCTCCACCAGTTCAAACTCAACTCGAGTTGAGTTTGAACTGGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-334s21c1
Sequence:CCGGAGAATGGGAAGCTTGGATTAGCTCGAGCTAATCCAAGCTTCCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-276s21c1
Sequence:CCGGGAATTGTAGAAGCAGCAAATACTCGAGTATTTGCTGCTTCTACAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-287s1c1
Sequence:CCGGCCACCTACTATGGAGGAAATACTCGAGTATTTCCTCCATAGTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-169s1c1
Sequence:CCGGAGGACAAACTATTCGAGAGAACTCGAGTTCTCTCGAATAGTTTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-117s1c1
Sequence:CCGGCGGACCAATTCGGGAACAAATCTCGAGATTTGTTCCCGAATTGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-407s1c1
Sequence:CCGGCCTCCACCAGTTCAAACTCAACTCGAGTTGAGTTTGAACTGGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-192s1c1
Sequence:CCGGGAATTGTAGAAGCAGCAAATACTCGAGTATTTGCTGCTTCTACAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174889
VALIDATED
NDUFAF2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-522s21c1
Sequence:CCGGATGCCTCTGCTCCATACTTTGCTCGAGCAAAGTATGGAGCAGAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-201s21c1
Sequence:CCGGCGGACCAATTCGGGAACAAATCTCGAGATTTGTTCCCGAATTGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-491s21c1
Sequence:CCGGCCTCCACCAGTTCAAACTCAACTCGAGTTGAGTTTGAACTGGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-334s21c1
Sequence:CCGGAGAATGGGAAGCTTGGATTAGCTCGAGCTAATCCAAGCTTCCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-276s21c1
Sequence:CCGGGAATTGTAGAAGCAGCAAATACTCGAGTATTTGCTGCTTCTACAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-287s1c1
Sequence:CCGGCCACCTACTATGGAGGAAATACTCGAGTATTTCCTCCATAGTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-169s1c1
Sequence:CCGGAGGACAAACTATTCGAGAGAACTCGAGTTCTCTCGAATAGTTTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-117s1c1
Sequence:CCGGCGGACCAATTCGGGAACAAATCTCGAGATTTGTTCCCGAATTGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-407s1c1
Sequence:CCGGCCTCCACCAGTTCAAACTCAACTCGAGTTGAGTTTGAACTGGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-192s1c1
Sequence:CCGGGAATTGTAGAAGCAGCAAATACTCGAGTATTTGCTGCTTCTACAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174889
VALIDATED
NDUFAF2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-522s21c1
Sequence:CCGGATGCCTCTGCTCCATACTTTGCTCGAGCAAAGTATGGAGCAGAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-201s21c1
Sequence:CCGGCGGACCAATTCGGGAACAAATCTCGAGATTTGTTCCCGAATTGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-491s21c1
Sequence:CCGGCCTCCACCAGTTCAAACTCAACTCGAGTTGAGTTTGAACTGGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-334s21c1
Sequence:CCGGAGAATGGGAAGCTTGGATTAGCTCGAGCTAATCCAAGCTTCCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174889.4-276s21c1
Sequence:CCGGGAATTGTAGAAGCAGCAAATACTCGAGTATTTGCTGCTTCTACAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-287s1c1
Sequence:CCGGCCACCTACTATGGAGGAAATACTCGAGTATTTCCTCCATAGTAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-169s1c1
Sequence:CCGGAGGACAAACTATTCGAGAGAACTCGAGTTCTCTCGAATAGTTTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-117s1c1
Sequence:CCGGCGGACCAATTCGGGAACAAATCTCGAGATTTGTTCCCGAATTGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-407s1c1
Sequence:CCGGCCTCCACCAGTTCAAACTCAACTCGAGTTGAGTTTGAACTGGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_174889.2-192s1c1
Sequence:CCGGGAATTGTAGAAGCAGCAAATACTCGAGTATTTGCTGCTTCTACAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127346
VALIDATED
NDUFAF2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-151s21c1
Sequence:CCGGACTACTACGTCGCCGAGTACACTCGAGTGTACTCGGCGACGTAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-262s21c1
Sequence:CCGGCCGAGTGGGAAGCATGGATTACTCGAGTAATCCATGCTTCCCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-423s21c1
Sequence:CCGGCCTACTGCAACTCAAGTTAAACTCGAGTTTAACTTGAGTTGCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-175s21c1
Sequence:CCGGACTGGAGAGGGCAGACTATTCCTCGAGGAATAGTCTGCCCTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127346.1-300s21c1
Sequence:CCGGCCACCCACTATGGAGGAAATACTCGAGTATTTCCTCCATAGTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127346
VALIDATED
NDUFAF2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-151s21c1
Sequence:CCGGACTACTACGTCGCCGAGTACACTCGAGTGTACTCGGCGACGTAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-262s21c1
Sequence:CCGGCCGAGTGGGAAGCATGGATTACTCGAGTAATCCATGCTTCCCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-423s21c1
Sequence:CCGGCCTACTGCAACTCAAGTTAAACTCGAGTTTAACTTGAGTTGCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-175s21c1
Sequence:CCGGACTGGAGAGGGCAGACTATTCCTCGAGGAATAGTCTGCCCTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127346.1-300s21c1
Sequence:CCGGCCACCCACTATGGAGGAAATACTCGAGTATTTCCTCCATAGTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127346
VALIDATED
NDUFAF2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-151s21c1
Sequence:CCGGACTACTACGTCGCCGAGTACACTCGAGTGTACTCGGCGACGTAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-262s21c1
Sequence:CCGGCCGAGTGGGAAGCATGGATTACTCGAGTAATCCATGCTTCCCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-423s21c1
Sequence:CCGGCCTACTGCAACTCAAGTTAAACTCGAGTTTAACTTGAGTTGCAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001127346.1-175s21c1
Sequence:CCGGACTGGAGAGGGCAGACTATTCCTCGAGGAATAGTCTGCCCTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127346.1-300s21c1
Sequence:CCGGCCACCCACTATGGAGGAAATACTCGAGTATTTCCTCCATAGTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)