EMAIL THIS PAGE TO A FRIEND

NDUFAF3

NADH dehydrogenase (ubiquinone) complex I, assembly factor 3

112 Gene Product Result for
Synonyms: 2P1 C3orf60 E3-3
UniProtKB ID: Q9BU61
Gene ID:
Human(25915) Summary: This gene encodes a mitochondrial complex I assembly protein that interacts with complex I subunits. Mutations in this gene cause mitochondrial complex I deficiency, a fatal neonatal disorder of the oxidative phosphorylation system. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2009]
Mouse(66706) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3
Rat(56769) NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
Zebrafish(791133) NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
cow(511968) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3
domestic cat(101080435) NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
dog(476631) NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
sheep(101108261) NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
naked mole-rat(101699477) NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
domestic guinea pig(100727428) NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199069 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199069 Rosetta Predictions human pricing
NM_199070 Rosetta Predictions human pricing
NM_199073 Rosetta Predictions human pricing
NM_199074 Rosetta Predictions human pricing
NM_199417 Rosetta Predictions human pricing
NM_001033971 Rosetta Predictions rat pricing
NM_020080 Rosetta Predictions rat pricing
NM_023247 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019532 predicted 915
2 SASI_Hs01_00019533 predicted 940
3 SASI_Hs01_00019534 predicted 1118
4 SASI_Hs01_00019536 predicted 1067
5 SASI_Hs01_00019538 predicted 1089
6 SASI_Hs01_00019539 predicted 1012
7 SASI_Hs01_00019540 predicted 1122
8 SASI_Hs01_00019541 predicted 964
9 SASI_Hs02_00372547 predicted 1111
10 SASI_Hs02_00372548 predicted 785
11 SASI_Hs01_00019535 predicted 1104
12 SASI_Hs01_00019537 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216983 predicted 473
2 SASI_Hs01_00216984 predicted 503
3 SASI_Hs01_00216985 predicted 677
4 SASI_Hs01_00216987 predicted 633
5 SASI_Hs01_00216989 predicted 658
6 SASI_Hs01_00216990 predicted 576
7 SASI_Hs01_00216991 predicted 684
8 SASI_Hs01_00216992 predicted 533
9 SASI_Hs02_00372549 predicted 672
10 SASI_Hs02_00372550 predicted 347
11 SASI_Hs01_00216986 predicted 670
12 SASI_Hs01_00216988 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070283 predicted 546
2 SASI_Hs01_00070284 predicted 576
3 SASI_Hs01_00070285 predicted 750
4 SASI_Hs01_00070287 predicted 699
5 SASI_Hs01_00070289 predicted 729
6 SASI_Hs01_00070290 predicted 649
7 SASI_Hs01_00070291 predicted 762
8 SASI_Hs01_00070292 predicted 599
9 SASI_Hs02_00372551 predicted 749
10 SASI_Hs02_00372552 predicted 420
11 SASI_Hs01_00070286 predicted 738
12 SASI_Hs01_00070288 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221722 predicted 422
2 SASI_Hs01_00221723 predicted 452
3 SASI_Hs01_00221724 predicted 632
4 SASI_Hs01_00221726 predicted 578
5 SASI_Hs01_00221728 predicted 610
6 SASI_Hs01_00221729 predicted 526
7 SASI_Hs01_00221730 predicted 640
8 SASI_Hs01_00221731 predicted 480
9 SASI_Hs02_00372553 predicted 626
10 SASI_Hs02_00372554 predicted 292
11 SASI_Hs01_00221725 predicted 614
12 SASI_Hs01_00221727 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074113 predicted 1031
2 SASI_Hs01_00074114 predicted 1059
3 SASI_Hs01_00074115 predicted 1247
4 SASI_Hs01_00074117 predicted 1190
5 SASI_Hs01_00074119 predicted 1216
6 SASI_Hs01_00074120 predicted 1138
7 SASI_Hs01_00074121 predicted 1247
8 SASI_Hs01_00074122 predicted 1092
9 SASI_Hs02_00372815 predicted 1237
10 SASI_Hs02_00372816 predicted 902
11 SASI_Hs01_00074116 predicted 1224
12 SASI_Hs01_00074118 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051981 predicted 1319
2 SASI_Rn01_00051982 predicted 1341
3 SASI_Rn01_00051983 predicted 1085
4 SASI_Rn01_00051985 predicted 968
5 SASI_Rn01_00051986 predicted 1195
6 SASI_Rn02_00203857 predicted 992
7 SASI_Rn01_00051988 predicted 1139
8 SASI_Rn01_00051989 predicted 1039
9 SASI_Rn01_00051990 predicted 1107
10 SASI_Rn02_00203858 predicted 1251
11 SASI_Rn01_00051984 predicted 1309
12 SASI_Rn01_00051987 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083321 predicted 1339
2 SASI_Rn01_00083322 predicted 1357
3 SASI_Rn01_00083323 predicted 1101
4 SASI_Rn01_00083325 predicted 983
5 SASI_Rn01_00083326 predicted 1210
6 SASI_Rn02_00262487 predicted 1006
7 SASI_Rn01_00083328 predicted 1155
8 SASI_Rn01_00083329 predicted 1056
9 SASI_Rn01_00083330 predicted 1131
10 SASI_Rn02_00262488 predicted 1271
11 SASI_Rn01_00083324 predicted 1335
12 SASI_Rn01_00083327 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053272 predicted 614
2 SASI_Mm01_00053273 predicted 608
3 SASI_Mm01_00053274 predicted 686
4 SASI_Mm01_00053275 predicted 717
5 SASI_Mm02_00327000 predicted 615
6 SASI_Mm01_00053276 predicted 836
7 SASI_Mm01_00053277 predicted 553
8 SASI_Mm01_00053278 predicted 586
9 SASI_Mm01_00053280 predicted 625
10 SASI_Mm01_00053281 predicted 747
11 SASI_Mm01_00053279 predicted 655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199069
VALIDATED
NDUFAF3 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199069.1-708s1c1
Sequence:CCGGCATGATAAACGGAAACCGCGTCTCGAGACGCGGTTTCCGTTTATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1016s1c1
Sequence:CCGGCAGGAGGGACTTCACTTACATCTCGAGATGTAAGTGAAGTCCCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1103s1c1
Sequence:CCGGCAATGCTTTCACTCTTATCTACTCGAGTAGATAAGAGTGAAAGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1108s1c1
Sequence:CCGGCTTTCACTCTTATCTACCCTTCTCGAGAAGGGTAGATAAGAGTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1126s1c1
Sequence:CCGGCTTTGGCACTTATCTTGCTTACTCGAGTAAGCAAGATAAGTGCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1019s1c1
Sequence:CCGGGAGGGACTTCACTTACATCTTCTCGAGAAGATGTAAGTGAAGTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_199069.1-1125s1c1
Sequence:CCGGCCTTTGGCACTTATCTTGCTTCTCGAGAAGCAAGATAAGTGCCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-674s1c1
Sequence:CCGGCAATGTACATCGACAGCTACACTCGAGTGTAGCTGTCGATGTACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-668s1c1
Sequence:CCGGCTCAGGCAATGTACATCGACACTCGAGTGTCGATGTACATTGCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199069.1-790s1c1
Sequence:CCGGGACATCACCGAAGACAGCTTTCTCGAGAAAGCTGTCTTCGGTGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_199069.1-701s1c1
Sequence:CCGGGCGGCTTCATGATAAACGGAACTCGAGTTCCGTTTATCATGAAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199069.1-678s1c1
Sequence:CCGGGTACATCGACAGCTACAACAGCTCGAGCTGTTGTAGCTGTCGATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199069.1-626s21c1
Sequence:CCGGTGTATCAGCGGACGCGCATCTCTCGAGAGATGCGCGTCCGCTGATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199069.1-918s21c1
Sequence:CCGGCATTGCTGTGGAAGTGCAGGACTCGAGTCCTGCACTTCCACAGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199069
VALIDATED
NDUFAF3 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199069.1-708s1c1
Sequence:CCGGCATGATAAACGGAAACCGCGTCTCGAGACGCGGTTTCCGTTTATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1016s1c1
Sequence:CCGGCAGGAGGGACTTCACTTACATCTCGAGATGTAAGTGAAGTCCCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1103s1c1
Sequence:CCGGCAATGCTTTCACTCTTATCTACTCGAGTAGATAAGAGTGAAAGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1108s1c1
Sequence:CCGGCTTTCACTCTTATCTACCCTTCTCGAGAAGGGTAGATAAGAGTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1126s1c1
Sequence:CCGGCTTTGGCACTTATCTTGCTTACTCGAGTAAGCAAGATAAGTGCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1019s1c1
Sequence:CCGGGAGGGACTTCACTTACATCTTCTCGAGAAGATGTAAGTGAAGTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_199069.1-1125s1c1
Sequence:CCGGCCTTTGGCACTTATCTTGCTTCTCGAGAAGCAAGATAAGTGCCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-674s1c1
Sequence:CCGGCAATGTACATCGACAGCTACACTCGAGTGTAGCTGTCGATGTACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-668s1c1
Sequence:CCGGCTCAGGCAATGTACATCGACACTCGAGTGTCGATGTACATTGCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199069.1-790s1c1
Sequence:CCGGGACATCACCGAAGACAGCTTTCTCGAGAAAGCTGTCTTCGGTGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_199069.1-701s1c1
Sequence:CCGGGCGGCTTCATGATAAACGGAACTCGAGTTCCGTTTATCATGAAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199069.1-678s1c1
Sequence:CCGGGTACATCGACAGCTACAACAGCTCGAGCTGTTGTAGCTGTCGATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199069.1-626s21c1
Sequence:CCGGTGTATCAGCGGACGCGCATCTCTCGAGAGATGCGCGTCCGCTGATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199069.1-918s21c1
Sequence:CCGGCATTGCTGTGGAAGTGCAGGACTCGAGTCCTGCACTTCCACAGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199069
VALIDATED
NDUFAF3 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199069.1-708s1c1
Sequence:CCGGCATGATAAACGGAAACCGCGTCTCGAGACGCGGTTTCCGTTTATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1016s1c1
Sequence:CCGGCAGGAGGGACTTCACTTACATCTCGAGATGTAAGTGAAGTCCCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1103s1c1
Sequence:CCGGCAATGCTTTCACTCTTATCTACTCGAGTAGATAAGAGTGAAAGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1108s1c1
Sequence:CCGGCTTTCACTCTTATCTACCCTTCTCGAGAAGGGTAGATAAGAGTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1126s1c1
Sequence:CCGGCTTTGGCACTTATCTTGCTTACTCGAGTAAGCAAGATAAGTGCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-1019s1c1
Sequence:CCGGGAGGGACTTCACTTACATCTTCTCGAGAAGATGTAAGTGAAGTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_199069.1-1125s1c1
Sequence:CCGGCCTTTGGCACTTATCTTGCTTCTCGAGAAGCAAGATAAGTGCCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-674s1c1
Sequence:CCGGCAATGTACATCGACAGCTACACTCGAGTGTAGCTGTCGATGTACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_199069.1-668s1c1
Sequence:CCGGCTCAGGCAATGTACATCGACACTCGAGTGTCGATGTACATTGCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199069.1-790s1c1
Sequence:CCGGGACATCACCGAAGACAGCTTTCTCGAGAAAGCTGTCTTCGGTGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_199069.1-701s1c1
Sequence:CCGGGCGGCTTCATGATAAACGGAACTCGAGTTCCGTTTATCATGAAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199069.1-678s1c1
Sequence:CCGGGTACATCGACAGCTACAACAGCTCGAGCTGTTGTAGCTGTCGATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199069.1-626s21c1
Sequence:CCGGTGTATCAGCGGACGCGCATCTCTCGAGAGATGCGCGTCCGCTGATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199069.1-918s21c1
Sequence:CCGGCATTGCTGTGGAAGTGCAGGACTCGAGTCCTGCACTTCCACAGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023247
NDUFAF3 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000266960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-695s21c1
Sequence:CCGGCGTGGGATCTCATCAGGATATCTCGAGATATCCTGATGAGATCCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-866s21c1
Sequence:CCGGCAATGCCTGTGCCACTTTCAACTCGAGTTGAAAGTGGCACAGGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-547s21c1
Sequence:CCGGTATACCAGCGGACTCGCATCTCTCGAGAGATGCGAGTCCGCTGGTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-748s21c1
Sequence:CCGGTGGAACCTAGGATAGAGATTGCTCGAGCAATCTCTATCCTAGGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-634s21c1
Sequence:CCGGTCTGCGGAAATCGCGTGTTTGCTCGAGCAAACACGCGATTTCCGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023247
NDUFAF3 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000266960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-695s21c1
Sequence:CCGGCGTGGGATCTCATCAGGATATCTCGAGATATCCTGATGAGATCCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-866s21c1
Sequence:CCGGCAATGCCTGTGCCACTTTCAACTCGAGTTGAAAGTGGCACAGGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-547s21c1
Sequence:CCGGTATACCAGCGGACTCGCATCTCTCGAGAGATGCGAGTCCGCTGGTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-748s21c1
Sequence:CCGGTGGAACCTAGGATAGAGATTGCTCGAGCAATCTCTATCCTAGGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-634s21c1
Sequence:CCGGTCTGCGGAAATCGCGTGTTTGCTCGAGCAAACACGCGATTTCCGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023247
NDUFAF3 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000266960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-695s21c1
Sequence:CCGGCGTGGGATCTCATCAGGATATCTCGAGATATCCTGATGAGATCCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-866s21c1
Sequence:CCGGCAATGCCTGTGCCACTTTCAACTCGAGTTGAAAGTGGCACAGGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-547s21c1
Sequence:CCGGTATACCAGCGGACTCGCATCTCTCGAGAGATGCGAGTCCGCTGGTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-748s21c1
Sequence:CCGGTGGAACCTAGGATAGAGATTGCTCGAGCAATCTCTATCCTAGGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023247.1-634s21c1
Sequence:CCGGTCTGCGGAAATCGCGTGTTTGCTCGAGCAAACACGCGATTTCCGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)