EMAIL THIS PAGE TO A FRIEND

NDUFAF4

NADH dehydrogenase (ubiquinone) complex I, assembly factor 4

55 Gene Product Result for
Synonyms: C6orf66 HRPAP20 My013 bA22L21.1
UniProtKB ID: Q9P032, B2R4J5
Gene ID:
Human(29078) Summary: NADH:ubiquinone oxidoreductase (complex I) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. This gene encodes a complex I assembly factor. Mutations in this gene are a cause of mitochondrial complex I deficiency. [provided by RefSeq, Oct 2009]
Mouse(68493) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4
Rat(362495) NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
domestic guinea pig(100720333) NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
naked mole-rat(101720511) NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
sheep(101105508) NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
Zebrafish(794169) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4
chicken(421802) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4
cow(615440) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4
domestic cat(101081384) NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
dog(475001) NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014165 Rosetta Predictions human pricing
NM_198783 Rosetta Predictions rat pricing
NM_026742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207927 predicted 338
2 SASI_Hs01_00207929 predicted 209
3 SASI_Hs01_00207931 predicted 327
4 SASI_Hs02_00345154 predicted 394
5 SASI_Hs02_00345155 predicted 232
6 SASI_Hs02_00345156 predicted 196
7 SASI_Hs01_00207923 predicted 432
8 SASI_Hs02_00345157 predicted 230
9 SASI_Hs02_00345158 predicted 227
10 SASI_Hs01_00207925 predicted 431
11 SASI_Hs01_00207924 predicted 235
12 SASI_Hs01_00207926 predicted 434
13 SASI_Hs01_00207928 predicted 428
14 SASI_Hs01_00207930 predicted 328
15 SASI_Hs01_00207932 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115446 predicted 1041
2 SASI_Rn01_00115447 predicted 1046
3 SASI_Rn01_00115449 predicted 387
4 SASI_Rn01_00115450 predicted 365
5 SASI_Rn02_00270056 predicted 401
6 SASI_Rn02_00270057 predicted 413
7 SASI_Rn01_00115451 predicted 387
8 SASI_Rn01_00115452 predicted 385
9 SASI_Rn01_00115453 predicted 220
10 SASI_Rn01_00115454 predicted 281
11 SASI_Rn01_00115448 predicted 1057
12 SASI_Rn01_00115455 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198074 predicted 351
2 SASI_Mm01_00198075 predicted 375
3 SASI_Mm01_00198076 predicted 249
4 SASI_Mm01_00198077 predicted 330
5 SASI_Mm01_00198078 predicted 204
6 SASI_Mm01_00198079 predicted 678
7 SASI_Mm01_00198080 predicted 352
8 SASI_Mm02_00330789 predicted 699
9 SASI_Mm01_00198081 predicted 387
10 SASI_Mm01_00198082 predicted 426
11 SASI_Mm01_00198083 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014165
VALIDATED
NDUFAF4 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-442s21c1
Sequence:CCGGGAAGCATTGACACTTCTCAATCTCGAGATTGAGAAGTGTCAATGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-347s21c1
Sequence:CCGGCATGTCAAGAGCCGAAGGAATCTCGAGATTCCTTCGGCTCTTGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-586s21c1
Sequence:CCGGCCTGAAGACAAGAAAGCAATACTCGAGTATTGCTTTCTTGTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-305s21c1
Sequence:CCGGCCAAAGATCCTGTGTCTTCCTCTCGAGAGGAAGACACAGGATCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-211s21c1
Sequence:CCGGCGAGAGCAGATTAGTCTCTATCTCGAGATAGAGACTAATCTGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014165.1-290s1c1
Sequence:CCGGGATTCCAAAGATCCTGTGTCTCTCGAGAGACACAGGATCTTTGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-303s1c1
Sequence:CCGGCTGTGTCTTCCTTGCAGGTAACTCGAGTTACCTGCAAGGAAGACACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-294s1c1
Sequence:CCGGCCAAAGATCCTGTGTCTTCCTCTCGAGAGGAAGACACAGGATCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-336s1c1
Sequence:CCGGCATGTCAAGAGCCGAAGGAATCTCGAGATTCCTTCGGCTCTTGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-470s1c1
Sequence:CCGGGAAACCTGGACTGCTGAGAAACTCGAGTTTCTCAGCAGTCCAGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-557s1c1
Sequence:CCGGGAAGTCGAAATCTTCCCTCCTCTCGAGAGGAGGGAAGATTTCGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-200s1c1
Sequence:CCGGCGAGAGCAGATTAGTCTCTATCTCGAGATAGAGACTAATCTGCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-199s1c1
Sequence:CCGGGCGAGAGCAGATTAGTCTCTACTCGAGTAGAGACTAATCTGCTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-572s1c1
Sequence:CCGGCCTCCTGAAGACAAGAAAGCACTCGAGTGCTTTCTTGTCTTCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-431s1c1
Sequence:CCGGGAAGCATTGACACTTCTCAATCTCGAGATTGAGAAGTGTCAATGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-496s1c1
Sequence:CCGGGCAAGAATACCAGTTAGAACACTCGAGTGTTCTAACTGGTATTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-575s1c1
Sequence:CCGGCCTGAAGACAAGAAAGCAATACTCGAGTATTGCTTTCTTGTCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-221s1c1
Sequence:CCGGCCAGAAGTTAAAGGAGAGATTCTCGAGAATCTCTCCTTTAACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014165.1-222s1c1
Sequence:CCGGCAGAAGTTAAAGGAGAGATTGCTCGAGCAATCTCTCCTTTAACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-206s1c1
Sequence:CCGGCAGATTAGTCTCTATCCAGAACTCGAGTTCTGGATAGAGACTAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014165
VALIDATED
NDUFAF4 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-442s21c1
Sequence:CCGGGAAGCATTGACACTTCTCAATCTCGAGATTGAGAAGTGTCAATGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-347s21c1
Sequence:CCGGCATGTCAAGAGCCGAAGGAATCTCGAGATTCCTTCGGCTCTTGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-586s21c1
Sequence:CCGGCCTGAAGACAAGAAAGCAATACTCGAGTATTGCTTTCTTGTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-305s21c1
Sequence:CCGGCCAAAGATCCTGTGTCTTCCTCTCGAGAGGAAGACACAGGATCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-211s21c1
Sequence:CCGGCGAGAGCAGATTAGTCTCTATCTCGAGATAGAGACTAATCTGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014165.1-290s1c1
Sequence:CCGGGATTCCAAAGATCCTGTGTCTCTCGAGAGACACAGGATCTTTGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-303s1c1
Sequence:CCGGCTGTGTCTTCCTTGCAGGTAACTCGAGTTACCTGCAAGGAAGACACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-294s1c1
Sequence:CCGGCCAAAGATCCTGTGTCTTCCTCTCGAGAGGAAGACACAGGATCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-336s1c1
Sequence:CCGGCATGTCAAGAGCCGAAGGAATCTCGAGATTCCTTCGGCTCTTGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-470s1c1
Sequence:CCGGGAAACCTGGACTGCTGAGAAACTCGAGTTTCTCAGCAGTCCAGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-557s1c1
Sequence:CCGGGAAGTCGAAATCTTCCCTCCTCTCGAGAGGAGGGAAGATTTCGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-200s1c1
Sequence:CCGGCGAGAGCAGATTAGTCTCTATCTCGAGATAGAGACTAATCTGCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-199s1c1
Sequence:CCGGGCGAGAGCAGATTAGTCTCTACTCGAGTAGAGACTAATCTGCTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-572s1c1
Sequence:CCGGCCTCCTGAAGACAAGAAAGCACTCGAGTGCTTTCTTGTCTTCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-431s1c1
Sequence:CCGGGAAGCATTGACACTTCTCAATCTCGAGATTGAGAAGTGTCAATGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-496s1c1
Sequence:CCGGGCAAGAATACCAGTTAGAACACTCGAGTGTTCTAACTGGTATTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-575s1c1
Sequence:CCGGCCTGAAGACAAGAAAGCAATACTCGAGTATTGCTTTCTTGTCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-221s1c1
Sequence:CCGGCCAGAAGTTAAAGGAGAGATTCTCGAGAATCTCTCCTTTAACTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014165.1-222s1c1
Sequence:CCGGCAGAAGTTAAAGGAGAGATTGCTCGAGCAATCTCTCCTTTAACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-206s1c1
Sequence:CCGGCAGATTAGTCTCTATCCAGAACTCGAGTTCTGGATAGAGACTAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014165
VALIDATED
NDUFAF4 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-442s21c1
Sequence:CCGGGAAGCATTGACACTTCTCAATCTCGAGATTGAGAAGTGTCAATGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-347s21c1
Sequence:CCGGCATGTCAAGAGCCGAAGGAATCTCGAGATTCCTTCGGCTCTTGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-586s21c1
Sequence:CCGGCCTGAAGACAAGAAAGCAATACTCGAGTATTGCTTTCTTGTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-305s21c1
Sequence:CCGGCCAAAGATCCTGTGTCTTCCTCTCGAGAGGAAGACACAGGATCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014165.2-211s21c1
Sequence:CCGGCGAGAGCAGATTAGTCTCTATCTCGAGATAGAGACTAATCTGCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014165.1-290s1c1
Sequence:CCGGGATTCCAAAGATCCTGTGTCTCTCGAGAGACACAGGATCTTTGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-303s1c1
Sequence:CCGGCTGTGTCTTCCTTGCAGGTAACTCGAGTTACCTGCAAGGAAGACACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-294s1c1
Sequence:CCGGCCAAAGATCCTGTGTCTTCCTCTCGAGAGGAAGACACAGGATCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-336s1c1
Sequence:CCGGCATGTCAAGAGCCGAAGGAATCTCGAGATTCCTTCGGCTCTTGACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-470s1c1
Sequence:CCGGGAAACCTGGACTGCTGAGAAACTCGAGTTTCTCAGCAGTCCAGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-557s1c1
Sequence:CCGGGAAGTCGAAATCTTCCCTCCTCTCGAGAGGAGGGAAGATTTCGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-200s1c1
Sequence:CCGGCGAGAGCAGATTAGTCTCTATCTCGAGATAGAGACTAATCTGCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-199s1c1
Sequence:CCGGGCGAGAGCAGATTAGTCTCTACTCGAGTAGAGACTAATCTGCTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-572s1c1
Sequence:CCGGCCTCCTGAAGACAAGAAAGCACTCGAGTGCTTTCTTGTCTTCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-431s1c1
Sequence:CCGGGAAGCATTGACACTTCTCAATCTCGAGATTGAGAAGTGTCAATGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-496s1c1
Sequence:CCGGGCAAGAATACCAGTTAGAACACTCGAGTGTTCTAACTGGTATTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-575s1c1
Sequence:CCGGCCTGAAGACAAGAAAGCAATACTCGAGTATTGCTTTCTTGTCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014165.1-221s1c1
Sequence:CCGGCCAGAAGTTAAAGGAGAGATTCTCGAGAATCTCTCCTTTAACTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014165.1-222s1c1
Sequence:CCGGCAGAAGTTAAAGGAGAGATTGCTCGAGCAATCTCTCCTTTAACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014165.1-206s1c1
Sequence:CCGGCAGATTAGTCTCTATCCAGAACTCGAGTTCTGGATAGAGACTAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026742
VALIDATED
NDUFAF4 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-475s21c1
Sequence:CCGGGCTCAAGAGTACTATTTAGAACTCGAGTTCTAAATAGTACTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-349s21c1
Sequence:CCGGCCGATAGGAAATCACTTTGATCTCGAGATCAAAGTGATTTCCTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026742.3-920s21c1
Sequence:CCGGGGGAAACACAGTGACTATATTCTCGAGAATATAGTCACTGTGTTTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-320s21c1
Sequence:CCGGCACGACAAGAACCAAAGGAATCTCGAGATTCCTTTGGTTCTTGTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-195s21c1
Sequence:CCGGCCGGAGTCAGTATCCAGAAATCTCGAGATTTCTGGATACTGACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-295s1c1
Sequence:CCGGCACGACAAGAACCAAAGGAATCTCGAGATTCCTTTGGTTCTTGTCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-324s1c1
Sequence:CCGGCCGATAGGAAATCACTTTGATCTCGAGATCAAAGTGATTTCCTATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-450s1c1
Sequence:CCGGGCTCAAGAGTACTATTTAGAACTCGAGTTCTAAATAGTACTCTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-170s1c1
Sequence:CCGGCCGGAGTCAGTATCCAGAAATCTCGAGATTTCTGGATACTGACTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-653s1c1
Sequence:CCGGTGAGGGCCATAACGTTTGAAACTCGAGTTTCAAACGTTATGGCCCTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026742
VALIDATED
NDUFAF4 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-475s21c1
Sequence:CCGGGCTCAAGAGTACTATTTAGAACTCGAGTTCTAAATAGTACTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-349s21c1
Sequence:CCGGCCGATAGGAAATCACTTTGATCTCGAGATCAAAGTGATTTCCTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026742.3-920s21c1
Sequence:CCGGGGGAAACACAGTGACTATATTCTCGAGAATATAGTCACTGTGTTTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-320s21c1
Sequence:CCGGCACGACAAGAACCAAAGGAATCTCGAGATTCCTTTGGTTCTTGTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-195s21c1
Sequence:CCGGCCGGAGTCAGTATCCAGAAATCTCGAGATTTCTGGATACTGACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-295s1c1
Sequence:CCGGCACGACAAGAACCAAAGGAATCTCGAGATTCCTTTGGTTCTTGTCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-324s1c1
Sequence:CCGGCCGATAGGAAATCACTTTGATCTCGAGATCAAAGTGATTTCCTATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-450s1c1
Sequence:CCGGGCTCAAGAGTACTATTTAGAACTCGAGTTCTAAATAGTACTCTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-170s1c1
Sequence:CCGGCCGGAGTCAGTATCCAGAAATCTCGAGATTTCTGGATACTGACTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-653s1c1
Sequence:CCGGTGAGGGCCATAACGTTTGAAACTCGAGTTTCAAACGTTATGGCCCTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026742
VALIDATED
NDUFAF4 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-475s21c1
Sequence:CCGGGCTCAAGAGTACTATTTAGAACTCGAGTTCTAAATAGTACTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-349s21c1
Sequence:CCGGCCGATAGGAAATCACTTTGATCTCGAGATCAAAGTGATTTCCTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026742.3-920s21c1
Sequence:CCGGGGGAAACACAGTGACTATATTCTCGAGAATATAGTCACTGTGTTTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-320s21c1
Sequence:CCGGCACGACAAGAACCAAAGGAATCTCGAGATTCCTTTGGTTCTTGTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026742.3-195s21c1
Sequence:CCGGCCGGAGTCAGTATCCAGAAATCTCGAGATTTCTGGATACTGACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-295s1c1
Sequence:CCGGCACGACAAGAACCAAAGGAATCTCGAGATTCCTTTGGTTCTTGTCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-324s1c1
Sequence:CCGGCCGATAGGAAATCACTTTGATCTCGAGATCAAAGTGATTTCCTATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-450s1c1
Sequence:CCGGGCTCAAGAGTACTATTTAGAACTCGAGTTCTAAATAGTACTCTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-170s1c1
Sequence:CCGGCCGGAGTCAGTATCCAGAAATCTCGAGATTTCTGGATACTGACTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026742.1-653s1c1
Sequence:CCGGTGAGGGCCATAACGTTTGAAACTCGAGTTTCAAACGTTATGGCCCTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)