EMAIL THIS PAGE TO A FRIEND

NDUFAF5

NADH dehydrogenase (ubiquinone) complex I, assembly factor 5

76 Gene Product Result for
Synonyms: C20orf7 bA526K24.2 dJ842G6.1
UniProtKB ID: Q5TEU4, A8K166, Q6GPH3, Q9H6F4
Gene ID:
Human(79133) Summary: The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes a mitochondrial protein that is associated with the matrix face of the mitochondrial inner membrane and is required for complex I assembly. A mutation in this gene results in mitochondrial complex I deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(69487) NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Rat(296190) NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Zebrafish(794020) NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
domestic cat(101096224) NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
dog(477150) NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
sheep(101111213) NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
naked mole-rat(101704983) NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
domestic guinea pig(100728734) NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024120 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039375 Rosetta Predictions human pricing
NM_024120 Rosetta Predictions human pricing
NM_001126371 Rosetta Predictions rat pricing
NM_027093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035025 predicted 650
2 SASI_Hs01_00035026 predicted 718
3 SASI_Hs01_00035027 predicted 755
4 SASI_Hs01_00035028 predicted 667
5 SASI_Hs01_00035029 predicted 651
6 SASI_Hs01_00035030 predicted 636
7 SASI_Hs01_00035031 predicted 642
8 SASI_Hs01_00035032 predicted 636
9 SASI_Hs01_00035033 predicted 659
10 SASI_Hs01_00035034 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237955 predicted 733
2 SASI_Hs01_00237956 predicted 804
3 SASI_Hs01_00237957 predicted 838
4 SASI_Hs01_00237958 predicted 744
5 SASI_Hs01_00237959 predicted 738
6 SASI_Hs01_00237960 predicted 719
7 SASI_Hs01_00237961 predicted 729
8 SASI_Hs01_00237962 predicted 713
9 SASI_Hs01_00237963 predicted 747
10 SASI_Hs01_00237964 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253413 predicted 337
2 SASI_Rn02_00253414 predicted 535
3 SASI_Rn02_00253415 predicted 783
4 SASI_Rn02_00253416 predicted 497
5 SASI_Rn02_00253417 predicted 247
6 SASI_Rn02_00253418 predicted 746
7 SASI_Rn02_00253419 predicted 723
8 SASI_Rn02_00253420 predicted 226
9 SASI_Rn02_00253421 predicted 412
10 SASI_Rn02_00253422 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092795 predicted 820
2 SASI_Mm02_00331520 predicted 363
3 SASI_Mm02_00331521 predicted 455
4 SASI_Mm01_00092796 predicted 781
5 SASI_Mm02_00331522 predicted 297
6 SASI_Mm02_00331523 predicted 1143
7 SASI_Mm01_00092798 predicted 763
8 SASI_Mm02_00331524 predicted 673
9 SASI_Mm02_00331525 predicted 376
10 SASI_Mm02_00331526 predicted 1040
11 SASI_Mm01_00092792 predicted 915
12 SASI_Mm01_00092793 predicted 850
13 SASI_Mm01_00092794 predicted 842
14 SASI_Mm01_00092797 predicted 709
15 SASI_Mm01_00092799 predicted 879
16 SASI_Mm01_00092800 predicted 719
17 SASI_Mm01_00092801 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024120
VALIDATED
NDUFAF5 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024120.2-1093s1c1
Sequence:CCGGCATCAGAAATGGATAGCTTTACTCGAGTAAAGCTATCCATTTCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024120.2-1232s1c1
Sequence:CCGGGTTTCTGTTCTCATAAGGATACTCGAGTATCCTTATGAGAACAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-212s1c1
Sequence:CCGGGCCGACCAAATTTGACTACCTCTCGAGAGGTAGTCAAATTTGGTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-486s1c1
Sequence:CCGGGTTAGCAGTTTAAGTTTGCATCTCGAGATGCAAACTTAAACTGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024120.2-319s1c1
Sequence:CCGGGAGGTTACATTGCACAATATTCTCGAGAATATTGTGCAATGTAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-316s1c1
Sequence:CCGGGAAGAGGTTACATTGCACAATCTCGAGATTGTGCAATGTAACCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024120.2-1475s1c1
Sequence:CCGGCTTTATTAAATCCCTCCTCAACTCGAGTTGAGGAGGGATTTAATAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-258s1c1
Sequence:CCGGGCAGACCGTGTATATGACATACTCGAGTATGTCATATACACGGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-264s1c1
Sequence:CCGGCGTGTATATGACATACCCAGACTCGAGTCTGGGTATGTCATATACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-912s1c1
Sequence:CCGGCCTGCTACATACCAGATCTATCTCGAGATAGATCTGGTATGTAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-598s1c1
Sequence:CCGGCACTCTATGAACTTCGGTGTTCTCGAGAACACCGAAGTTCATAGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024120
VALIDATED
NDUFAF5 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024120.2-1093s1c1
Sequence:CCGGCATCAGAAATGGATAGCTTTACTCGAGTAAAGCTATCCATTTCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024120.2-1232s1c1
Sequence:CCGGGTTTCTGTTCTCATAAGGATACTCGAGTATCCTTATGAGAACAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-212s1c1
Sequence:CCGGGCCGACCAAATTTGACTACCTCTCGAGAGGTAGTCAAATTTGGTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-486s1c1
Sequence:CCGGGTTAGCAGTTTAAGTTTGCATCTCGAGATGCAAACTTAAACTGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024120.2-319s1c1
Sequence:CCGGGAGGTTACATTGCACAATATTCTCGAGAATATTGTGCAATGTAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-316s1c1
Sequence:CCGGGAAGAGGTTACATTGCACAATCTCGAGATTGTGCAATGTAACCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024120.2-1475s1c1
Sequence:CCGGCTTTATTAAATCCCTCCTCAACTCGAGTTGAGGAGGGATTTAATAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-258s1c1
Sequence:CCGGGCAGACCGTGTATATGACATACTCGAGTATGTCATATACACGGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-264s1c1
Sequence:CCGGCGTGTATATGACATACCCAGACTCGAGTCTGGGTATGTCATATACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-912s1c1
Sequence:CCGGCCTGCTACATACCAGATCTATCTCGAGATAGATCTGGTATGTAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-598s1c1
Sequence:CCGGCACTCTATGAACTTCGGTGTTCTCGAGAACACCGAAGTTCATAGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024120
VALIDATED
NDUFAF5 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024120.2-1093s1c1
Sequence:CCGGCATCAGAAATGGATAGCTTTACTCGAGTAAAGCTATCCATTTCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024120.2-1232s1c1
Sequence:CCGGGTTTCTGTTCTCATAAGGATACTCGAGTATCCTTATGAGAACAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-212s1c1
Sequence:CCGGGCCGACCAAATTTGACTACCTCTCGAGAGGTAGTCAAATTTGGTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-486s1c1
Sequence:CCGGGTTAGCAGTTTAAGTTTGCATCTCGAGATGCAAACTTAAACTGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024120.2-319s1c1
Sequence:CCGGGAGGTTACATTGCACAATATTCTCGAGAATATTGTGCAATGTAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-316s1c1
Sequence:CCGGGAAGAGGTTACATTGCACAATCTCGAGATTGTGCAATGTAACCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024120.2-1475s1c1
Sequence:CCGGCTTTATTAAATCCCTCCTCAACTCGAGTTGAGGAGGGATTTAATAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-258s1c1
Sequence:CCGGGCAGACCGTGTATATGACATACTCGAGTATGTCATATACACGGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-264s1c1
Sequence:CCGGCGTGTATATGACATACCCAGACTCGAGTCTGGGTATGTCATATACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-912s1c1
Sequence:CCGGCCTGCTACATACCAGATCTATCTCGAGATAGATCTGGTATGTAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024120.2-598s1c1
Sequence:CCGGCACTCTATGAACTTCGGTGTTCTCGAGAACACCGAAGTTCATAGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027093
VALIDATED
NDUFAF5 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027093.4-2265s1c1
Sequence:CCGGCTATTGCACTATTATCCTAAACTCGAGTTTAGGATAATAGTGCAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027093.1-1004s1c1
Sequence:CCGGCGGAATGAGGATGGTTCCATACTCGAGTATGGAACCATCCTCATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-773s1c1
Sequence:CCGGCCACATATTTCTCCTTTCACTCTCGAGAGTGAAAGGAGAAATATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027093.4-672s21c1
Sequence:CCGGGCTAGCAGAAACTGAAAGGGACTCGAGTCCCTTTCAGTTTCTGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027093.4-1187s1c1
Sequence:CCGGGTGCAACCGATTGAGCTATTTCTCGAGAAATAGCTCAATCGGTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027093.1-743s1c1
Sequence:CCGGGCAGAAACTGAAAGGGAAGGACTCGAGTCCTTCCCTTTCAGTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027093.4-706s21c1
Sequence:CCGGCCACATATTTCTCCTTTCACTCTCGAGAGTGAAAGGAGAAATATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-924s1c1
Sequence:CCGGGCAACTGTTCTTGGAACAGAACTCGAGTTCTGTTCCAAGAACAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027093.4-297s21c1
Sequence:CCGGTCGGATTGCAGACCGTGTTTACTCGAGTAAACACGGTCTGCAATCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027093.4-954s21c1
Sequence:CCGGCATACCTGCCACCTTTCAGATCTCGAGATCTGAAAGGTGGCAGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-739s1c1
Sequence:CCGGGCTAGCAGAAACTGAAAGGGACTCGAGTCCCTTTCAGTTTCTGCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-995s1c1
Sequence:CCGGGAAATGTACCGGAATGAGGATCTCGAGATCCTCATTCCGGTACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027093.1-1021s1c1
Sequence:CCGGCATACCTGCCACCTTTCAGATCTCGAGATCTGAAAGGTGGCAGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027093
VALIDATED
NDUFAF5 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027093.4-2265s1c1
Sequence:CCGGCTATTGCACTATTATCCTAAACTCGAGTTTAGGATAATAGTGCAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027093.1-1004s1c1
Sequence:CCGGCGGAATGAGGATGGTTCCATACTCGAGTATGGAACCATCCTCATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-773s1c1
Sequence:CCGGCCACATATTTCTCCTTTCACTCTCGAGAGTGAAAGGAGAAATATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027093.4-672s21c1
Sequence:CCGGGCTAGCAGAAACTGAAAGGGACTCGAGTCCCTTTCAGTTTCTGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027093.4-1187s1c1
Sequence:CCGGGTGCAACCGATTGAGCTATTTCTCGAGAAATAGCTCAATCGGTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027093.1-743s1c1
Sequence:CCGGGCAGAAACTGAAAGGGAAGGACTCGAGTCCTTCCCTTTCAGTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027093.4-706s21c1
Sequence:CCGGCCACATATTTCTCCTTTCACTCTCGAGAGTGAAAGGAGAAATATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-924s1c1
Sequence:CCGGGCAACTGTTCTTGGAACAGAACTCGAGTTCTGTTCCAAGAACAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027093.4-297s21c1
Sequence:CCGGTCGGATTGCAGACCGTGTTTACTCGAGTAAACACGGTCTGCAATCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027093.4-954s21c1
Sequence:CCGGCATACCTGCCACCTTTCAGATCTCGAGATCTGAAAGGTGGCAGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-739s1c1
Sequence:CCGGGCTAGCAGAAACTGAAAGGGACTCGAGTCCCTTTCAGTTTCTGCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-995s1c1
Sequence:CCGGGAAATGTACCGGAATGAGGATCTCGAGATCCTCATTCCGGTACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027093.1-1021s1c1
Sequence:CCGGCATACCTGCCACCTTTCAGATCTCGAGATCTGAAAGGTGGCAGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027093
VALIDATED
NDUFAF5 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027093.4-2265s1c1
Sequence:CCGGCTATTGCACTATTATCCTAAACTCGAGTTTAGGATAATAGTGCAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027093.1-1004s1c1
Sequence:CCGGCGGAATGAGGATGGTTCCATACTCGAGTATGGAACCATCCTCATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-773s1c1
Sequence:CCGGCCACATATTTCTCCTTTCACTCTCGAGAGTGAAAGGAGAAATATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027093.4-672s21c1
Sequence:CCGGGCTAGCAGAAACTGAAAGGGACTCGAGTCCCTTTCAGTTTCTGCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027093.4-1187s1c1
Sequence:CCGGGTGCAACCGATTGAGCTATTTCTCGAGAAATAGCTCAATCGGTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027093.1-743s1c1
Sequence:CCGGGCAGAAACTGAAAGGGAAGGACTCGAGTCCTTCCCTTTCAGTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027093.4-706s21c1
Sequence:CCGGCCACATATTTCTCCTTTCACTCTCGAGAGTGAAAGGAGAAATATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-924s1c1
Sequence:CCGGGCAACTGTTCTTGGAACAGAACTCGAGTTCTGTTCCAAGAACAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027093.4-297s21c1
Sequence:CCGGTCGGATTGCAGACCGTGTTTACTCGAGTAAACACGGTCTGCAATCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027093.4-954s21c1
Sequence:CCGGCATACCTGCCACCTTTCAGATCTCGAGATCTGAAAGGTGGCAGGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-739s1c1
Sequence:CCGGGCTAGCAGAAACTGAAAGGGACTCGAGTCCCTTTCAGTTTCTGCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027093.1-995s1c1
Sequence:CCGGGAAATGTACCGGAATGAGGATCTCGAGATCCTCATTCCGGTACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027093.1-1021s1c1
Sequence:CCGGCATACCTGCCACCTTTCAGATCTCGAGATCTGAAAGGTGGCAGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)