EMAIL THIS PAGE TO A FRIEND

NDUFAF7

NADH dehydrogenase (ubiquinone) complex I, assembly factor 7

81 Gene Product Result for
Synonyms: C2orf56 MidA
UniProtKB ID: Q7L592, Q7Z399, Q9P1G3
Gene ID:
Mouse(73694) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex assembly factor 7
Rat(298748) NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
Zebrafish(767796) NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
cow(504290) chromosome 11 open reading frame, human C2orf56
domestic cat(101101128) NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
dog(475725) NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
sheep(101120907) NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
naked mole-rat(101697184) NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
domestic guinea pig(100717946) NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001083946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001083946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001083946 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083946 Rosetta Predictions human pricing
NM_018607 Rosetta Predictions human pricing
NM_144736 Rosetta Predictions human pricing
NM_001008318 Rosetta Predictions rat pricing
NM_028611 Rosetta Predictions mouse pricing
NM_144760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317331 predicted 1163
2 SASI_Hs02_00317332 predicted 778
3 SASI_Hs02_00317333 predicted 1065
4 SASI_Hs02_00317334 predicted 1030
5 SASI_Hs02_00317335 predicted 932
6 SASI_Hs02_00317336 predicted 1031
7 SASI_Hs02_00317337 predicted 795
8 SASI_Hs02_00317338 predicted 864
9 SASI_Hs02_00317339 predicted 784
10 SASI_Hs02_00317340 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012141 predicted 260
2 SASI_Hs01_00012142 predicted 906
3 SASI_Hs01_00012143 predicted 748
4 SASI_Hs01_00012144 predicted 1058
5 SASI_Hs01_00012145 predicted 270
6 SASI_Hs01_00012146 predicted 927
7 SASI_Hs01_00012147 predicted 994
8 SASI_Hs01_00012148 predicted 905
9 SASI_Hs01_00012149 predicted 1074
10 SASI_Hs01_00012150 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364698 predicted 1453
2 SASI_Hs01_00102419 predicted 1073
3 SASI_Hs01_00102420 predicted 1359
4 SASI_Hs02_00364699 predicted 1324
5 SASI_Hs01_00102421 predicted 1221
6 SASI_Hs01_00102423 predicted 1322
7 SASI_Hs02_00364700 predicted 1091
8 SASI_Hs02_00364701 predicted 1161
9 SASI_Hs02_00364702 predicted 1076
10 SASI_Hs02_00364703 predicted 1357
11 SASI_Hs01_00102415 predicted 266
12 SASI_Hs01_00102416 predicted 217
13 SASI_Hs01_00102417 predicted 1276
14 SASI_Hs01_00102418 predicted 1365
15 SASI_Hs01_00102422 predicted 270
16 SASI_Hs01_00102424 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044438 predicted 1087
2 SASI_Rn01_00044439 predicted 1196
3 SASI_Rn01_00044440 predicted 315
4 SASI_Rn01_00044441 predicted 1309
5 SASI_Rn01_00044442 predicted 1367
6 SASI_Rn01_00044443 predicted 1363
7 SASI_Rn01_00044444 predicted 890
8 SASI_Rn01_00044445 predicted 445
9 SASI_Rn01_00044446 predicted 1359
10 SASI_Rn01_00044447 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334099 predicted 487
2 SASI_Mm02_00334100 predicted 271
3 SASI_Mm02_00334101 predicted 1208
4 SASI_Mm02_00334102 predicted 1100
5 SASI_Mm02_00334103 predicted 1209
6 SASI_Mm02_00334104 predicted 576
7 SASI_Mm02_00334105 predicted 456
8 SASI_Mm02_00334106 predicted 1161
9 SASI_Mm02_00334107 predicted 358
10 SASI_Mm02_00334108 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114421 predicted 411
2 SASI_Mm01_00114422 predicted 363
3 SASI_Mm01_00114423 predicted 444
4 SASI_Mm01_00114424 predicted 349
5 SASI_Mm01_00114425 predicted 404
6 SASI_Mm01_00114426 predicted 315
7 SASI_Mm01_00114427 predicted 402
8 SASI_Mm01_00114428 predicted 403
9 SASI_Mm01_00114429 predicted 359
10 SASI_Mm01_00114430 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018607
VALIDATED
NDUFAF7 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000172909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018607.4-696s1c1
Sequence:CCGGGAGGAATGCACGTCAGTCAAACTCGAGTTTGACTGACGTGCATTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018607.4-660s1c1
Sequence:CCGGGCTACCTCATCAGAGACTTCACTCGAGTGAAGTCTCTGATGAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018607.4-559s1c1
Sequence:CCGGGATAAATCAAATGAGCCATCACTCGAGTGATGGCTCATTTGATTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018607.4-586s1c1
Sequence:CCGGCAGCAGTTACTTCAAGGATATCTCGAGATATCCTTGAAGTAACTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018607
VALIDATED
NDUFAF7 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000172909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018607.4-696s1c1
Sequence:CCGGGAGGAATGCACGTCAGTCAAACTCGAGTTTGACTGACGTGCATTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018607.4-660s1c1
Sequence:CCGGGCTACCTCATCAGAGACTTCACTCGAGTGAAGTCTCTGATGAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018607.4-559s1c1
Sequence:CCGGGATAAATCAAATGAGCCATCACTCGAGTGATGGCTCATTTGATTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018607.4-586s1c1
Sequence:CCGGCAGCAGTTACTTCAAGGATATCTCGAGATATCCTTGAAGTAACTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018607
VALIDATED
NDUFAF7 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000172909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018607.4-696s1c1
Sequence:CCGGGAGGAATGCACGTCAGTCAAACTCGAGTTTGACTGACGTGCATTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018607.4-660s1c1
Sequence:CCGGGCTACCTCATCAGAGACTTCACTCGAGTGAAGTCTCTGATGAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018607.4-559s1c1
Sequence:CCGGGATAAATCAAATGAGCCATCACTCGAGTGATGGCTCATTTGATTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018607.4-586s1c1
Sequence:CCGGCAGCAGTTACTTCAAGGATATCTCGAGATATCCTTGAAGTAACTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028611
VALIDATED
NDUFAF7 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028611.3-897s21c1
Sequence:CCGGTGCAGCCCTGATTGCGGATTACTCGAGTAATCCGCAATCAGGGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028611.3-1167s21c1
Sequence:CCGGGCTACTTGGAGGGTATGATATCTCGAGATATCATACCCTCCAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028611.3-540s21c1
Sequence:CCGGATTGGAGAGAGACGCTGAATCCTCGAGGATTCAGCGTCTCTCTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028611.3-1837s21c1
Sequence:CCGGGATAAGGTAAATGGCTATTTCCTCGAGGAAATAGCCATTTACCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028611.3-398s21c1
Sequence:CCGGGCACCCTCACAGCAGATATTTCTCGAGAAATATCTGCTGTGAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028611
VALIDATED
NDUFAF7 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028611.3-897s21c1
Sequence:CCGGTGCAGCCCTGATTGCGGATTACTCGAGTAATCCGCAATCAGGGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028611.3-1167s21c1
Sequence:CCGGGCTACTTGGAGGGTATGATATCTCGAGATATCATACCCTCCAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028611.3-540s21c1
Sequence:CCGGATTGGAGAGAGACGCTGAATCCTCGAGGATTCAGCGTCTCTCTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028611.3-1837s21c1
Sequence:CCGGGATAAGGTAAATGGCTATTTCCTCGAGGAAATAGCCATTTACCTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028611.3-398s21c1
Sequence:CCGGGCACCCTCACAGCAGATATTTCTCGAGAAATATCTGCTGTGAGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028611
VALIDATED
NDUFAF7 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028611.3-897s21c1
Sequence:CCGGTGCAGCCCTGATTGCGGATTACTCGAGTAATCCGCAATCAGGGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028611.3-1167s21c1
Sequence:CCGGGCTACTTGGAGGGTATGATATCTCGAGATATCATACCCTCCAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028611.3-540s21c1
Sequence:CCGGATTGGAGAGAGACGCTGAATCCTCGAGGATTCAGCGTCTCTCTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028611.3-1837s21c1
Sequence:CCGGGATAAGGTAAATGGCTATTTCCTCGAGGAAATAGCCATTTACCTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028611.3-398s21c1
Sequence:CCGGGCACCCTCACAGCAGATATTTCTCGAGAAATATCTGCTGTGAGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001083946
NDUFAF7 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083946.1-293s21c1
Sequence:CCGGTACTAGGTATATGGTTCATTACTCGAGTAATGAACCATATACCTAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083946.1-1092s21c1
Sequence:GTACCGGACTTGCTTGGCAGTGATATTTCTCGAGAAATATCACTGCCAAGCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083946.1-1343s21c1
Sequence:GTACCGGCAAAGCTAGTTGCCATATTTCCTCGAGGAAATATGGCAACTAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083946.1-1289s21c1
Sequence:GTACCGGCAAATGTGTGCTCAAGCTAATCTCGAGATTAGCTTGAGCACACATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083946.1-377s21c1
Sequence:CCGGGAACCCTCGTGGGAGATATTTCTCGAGAAATATCTCCCACGAGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001083946
NDUFAF7 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083946.1-293s21c1
Sequence:CCGGTACTAGGTATATGGTTCATTACTCGAGTAATGAACCATATACCTAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083946.1-1092s21c1
Sequence:GTACCGGACTTGCTTGGCAGTGATATTTCTCGAGAAATATCACTGCCAAGCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083946.1-1343s21c1
Sequence:GTACCGGCAAAGCTAGTTGCCATATTTCCTCGAGGAAATATGGCAACTAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083946.1-1289s21c1
Sequence:GTACCGGCAAATGTGTGCTCAAGCTAATCTCGAGATTAGCTTGAGCACACATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083946.1-377s21c1
Sequence:CCGGGAACCCTCGTGGGAGATATTTCTCGAGAAATATCTCCCACGAGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001083946
NDUFAF7 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) complex I, assembly factor 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083946.1-293s21c1
Sequence:CCGGTACTAGGTATATGGTTCATTACTCGAGTAATGAACCATATACCTAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083946.1-1092s21c1
Sequence:GTACCGGACTTGCTTGGCAGTGATATTTCTCGAGAAATATCACTGCCAAGCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083946.1-1343s21c1
Sequence:GTACCGGCAAAGCTAGTTGCCATATTTCCTCGAGGAAATATGGCAACTAGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083946.1-1289s21c1
Sequence:GTACCGGCAAATGTGTGCTCAAGCTAATCTCGAGATTAGCTTGAGCACACATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083946.1-377s21c1
Sequence:CCGGGAACCCTCGTGGGAGATATTTCTCGAGAAATATCTCCCACGAGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)