EMAIL THIS PAGE TO A FRIEND

NDUFB10

NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa

57 Gene Product Result for
Synonyms: PDSW
UniProtKB ID: O96000
Gene ID:
Mouse(68342) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10
Rat(681418) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10
Zebrafish(393703) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10
chicken(416543) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
domestic cat(101083475) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
cow(327701) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
dog(479887) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
sheep(101112370) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
naked mole-rat(101723731) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
domestic guinea pig(100731236) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004548 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026371 MISSION® esiRNA esiRNA targeting mouse Ndufb10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004548 Rosetta Predictions human pricing
NM_001109443 Rosetta Predictions rat pricing
NM_026684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240456 predicted 336
2 SASI_Hs01_00240457 predicted 317
3 SASI_Hs01_00240458 predicted 254
4 SASI_Hs01_00240459 predicted 254
5 SASI_Hs02_00337861 predicted 415
6 SASI_Hs01_00240460 predicted 356
7 SASI_Hs01_00240462 predicted 447
8 SASI_Hs01_00240463 predicted 379
9 SASI_Hs01_00240464 predicted 399
10 SASI_Hs01_00240465 predicted 326
11 SASI_Hs01_00240461 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248457 predicted 250
2 SASI_Rn02_00248458 predicted 250
3 SASI_Rn02_00248459 predicted 411
4 SASI_Rn02_00248460 predicted 224
5 SASI_Rn02_00248461 predicted 226
6 SASI_Rn02_00248462 predicted 405
7 SASI_Rn02_00248463 predicted 224
8 SASI_Rn02_00248464 predicted 369
9 SASI_Rn02_00248465 predicted 306
10 SASI_Rn02_00248466 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144404 predicted 289
2 SASI_Mm01_00144405 predicted 216
3 SASI_Mm02_00330719 predicted 404
4 SASI_Mm01_00144406 predicted 379
5 SASI_Mm01_00144407 predicted 322
6 SASI_Mm01_00144408 predicted 289
7 SASI_Mm01_00144410 predicted 259
8 SASI_Mm01_00144411 predicted 220
9 SASI_Mm01_00144413 predicted 230
10 SASI_Mm02_00330720 predicted 267
11 SASI_Mm01_00144409 predicted 320
12 SASI_Mm01_00144412 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004548
VALIDATED
NDUFB10 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-452s1c1
Sequence:CCGGGCAGAACTGTATCAAGGAAGTCTCGAGACTTCCTTGATACAGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-251s1c1
Sequence:CCGGGCACGCAAAGAACAGGTATTACTCGAGTAATACCTGTTCTTTGCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-380s1c1
Sequence:CCGGCGACCAAGAAATTATCAACATCTCGAGATGTTGATAATTTCTTGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-324s1c1
Sequence:CCGGGAGGACATCATGTGCATGTATCTCGAGATACATGCACATGATGTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-171s1c1
Sequence:CCGGCCCATCGTCTACATGATGAAACTCGAGTTTCATCATGTAGACGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-398s1c1
Sequence:CCGGCATTATGCAGGATCGGCTCAACTCGAGTTGAGCCGATCCTGCATAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-395s1c1
Sequence:CCGGCAACATTATGCAGGATCGGCTCTCGAGAGCCGATCCTGCATAATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004548.1-569s1c1
Sequence:CCGGGAGGATGCTGCAAGAGAGAAACTCGAGTTTCTCTCTTGCAGCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-176s1c1
Sequence:CCGGCGTCTACATGATGAAAGCGTTCTCGAGAACGCTTTCATCATGTAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-455s1c1
Sequence:CCGGGAACTGTATCAAGGAAGTGGACTCGAGTCCACTTCCTTGATACAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004548.1-230s1c1
Sequence:CCGGGAGAGAATTTATAGAGCGGCACTCGAGTGCCGCTCTATAAATTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004548.1-185s1c1
Sequence:CCGGGATGAAAGCGTTCGACCTCATCTCGAGATGAGGTCGAACGCTTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-219s1c1
Sequence:CCGGGTGACCCTCGTGAGAGAATTTCTCGAGAAATTCTCTCACGAGGGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004548
VALIDATED
NDUFB10 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-452s1c1
Sequence:CCGGGCAGAACTGTATCAAGGAAGTCTCGAGACTTCCTTGATACAGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-251s1c1
Sequence:CCGGGCACGCAAAGAACAGGTATTACTCGAGTAATACCTGTTCTTTGCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-380s1c1
Sequence:CCGGCGACCAAGAAATTATCAACATCTCGAGATGTTGATAATTTCTTGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-324s1c1
Sequence:CCGGGAGGACATCATGTGCATGTATCTCGAGATACATGCACATGATGTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-171s1c1
Sequence:CCGGCCCATCGTCTACATGATGAAACTCGAGTTTCATCATGTAGACGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-398s1c1
Sequence:CCGGCATTATGCAGGATCGGCTCAACTCGAGTTGAGCCGATCCTGCATAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-395s1c1
Sequence:CCGGCAACATTATGCAGGATCGGCTCTCGAGAGCCGATCCTGCATAATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004548.1-569s1c1
Sequence:CCGGGAGGATGCTGCAAGAGAGAAACTCGAGTTTCTCTCTTGCAGCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-176s1c1
Sequence:CCGGCGTCTACATGATGAAAGCGTTCTCGAGAACGCTTTCATCATGTAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-455s1c1
Sequence:CCGGGAACTGTATCAAGGAAGTGGACTCGAGTCCACTTCCTTGATACAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004548.1-230s1c1
Sequence:CCGGGAGAGAATTTATAGAGCGGCACTCGAGTGCCGCTCTATAAATTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004548.1-185s1c1
Sequence:CCGGGATGAAAGCGTTCGACCTCATCTCGAGATGAGGTCGAACGCTTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-219s1c1
Sequence:CCGGGTGACCCTCGTGAGAGAATTTCTCGAGAAATTCTCTCACGAGGGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004548
VALIDATED
NDUFB10 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-452s1c1
Sequence:CCGGGCAGAACTGTATCAAGGAAGTCTCGAGACTTCCTTGATACAGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-251s1c1
Sequence:CCGGGCACGCAAAGAACAGGTATTACTCGAGTAATACCTGTTCTTTGCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-380s1c1
Sequence:CCGGCGACCAAGAAATTATCAACATCTCGAGATGTTGATAATTTCTTGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-324s1c1
Sequence:CCGGGAGGACATCATGTGCATGTATCTCGAGATACATGCACATGATGTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-171s1c1
Sequence:CCGGCCCATCGTCTACATGATGAAACTCGAGTTTCATCATGTAGACGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-398s1c1
Sequence:CCGGCATTATGCAGGATCGGCTCAACTCGAGTTGAGCCGATCCTGCATAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-395s1c1
Sequence:CCGGCAACATTATGCAGGATCGGCTCTCGAGAGCCGATCCTGCATAATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004548.1-569s1c1
Sequence:CCGGGAGGATGCTGCAAGAGAGAAACTCGAGTTTCTCTCTTGCAGCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-176s1c1
Sequence:CCGGCGTCTACATGATGAAAGCGTTCTCGAGAACGCTTTCATCATGTAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-455s1c1
Sequence:CCGGGAACTGTATCAAGGAAGTGGACTCGAGTCCACTTCCTTGATACAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004548.1-230s1c1
Sequence:CCGGGAGAGAATTTATAGAGCGGCACTCGAGTGCCGCTCTATAAATTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004548.1-185s1c1
Sequence:CCGGGATGAAAGCGTTCGACCTCATCTCGAGATGAGGTCGAACGCTTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004548.1-219s1c1
Sequence:CCGGGTGACCCTCGTGAGAGAATTTCTCGAGAAATTCTCTCACGAGGGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026684
VALIDATED
NDUFB10 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026684.1-339s1c1
Sequence:CCGGCTTCAAAGTTGACCAGGAGATCTCGAGATCTCCTGGTCAACTTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026684.1-444s1c1
Sequence:CCGGGCAGTTCACCAAAGTGACTAACTCGAGTTAGTCACTTTGGTGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026684.1-409s1c1
Sequence:CCGGGAGAACTACCAGCAGAACTGTCTCGAGACAGTTCTGCTGGTAGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026684.1-276s1c1
Sequence:CCGGCACAGAATGCAAAGAGGGTGACTCGAGTCACCCTCTTTGCATTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026684.1-193s1c1
Sequence:CCGGCTCGTGAGAGAGTTTATTGAACTCGAGTTCAATAAACTCTCTCACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026684
VALIDATED
NDUFB10 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026684.1-339s1c1
Sequence:CCGGCTTCAAAGTTGACCAGGAGATCTCGAGATCTCCTGGTCAACTTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026684.1-444s1c1
Sequence:CCGGGCAGTTCACCAAAGTGACTAACTCGAGTTAGTCACTTTGGTGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026684.1-409s1c1
Sequence:CCGGGAGAACTACCAGCAGAACTGTCTCGAGACAGTTCTGCTGGTAGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026684.1-276s1c1
Sequence:CCGGCACAGAATGCAAAGAGGGTGACTCGAGTCACCCTCTTTGCATTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026684.1-193s1c1
Sequence:CCGGCTCGTGAGAGAGTTTATTGAACTCGAGTTCAATAAACTCTCTCACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026684
VALIDATED
NDUFB10 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026684.1-339s1c1
Sequence:CCGGCTTCAAAGTTGACCAGGAGATCTCGAGATCTCCTGGTCAACTTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026684.1-444s1c1
Sequence:CCGGGCAGTTCACCAAAGTGACTAACTCGAGTTAGTCACTTTGGTGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026684.1-409s1c1
Sequence:CCGGGAGAACTACCAGCAGAACTGTCTCGAGACAGTTCTGCTGGTAGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026684.1-276s1c1
Sequence:CCGGCACAGAATGCAAAGAGGGTGACTCGAGTCACCCTCTTTGCATTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026684.1-193s1c1
Sequence:CCGGCTCGTGAGAGAGTTTATTGAACTCGAGTTCAATAAACTCTCTCACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)