EMAIL THIS PAGE TO A FRIEND

NDUFB11

NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa

56 Gene Product Result for
Synonyms: CI-ESSS ESSS NP17.3 Np15 P17.3
UniProtKB ID: Q9NX14, Q5JRR3, Q5JRR4, Q6IAB6, Q8WZ96, Q9BXX9
Gene ID:
Human(54539) Summary: NDUFB11 is a component of mitochondrial complex I. Complex I catalyzes the first step in the electron transport chain, the transfer of 2 electrons from NADH to ubiquinone, coupled to the translocation of 4 protons across the membrane (Carroll et al., 2002 [PubMed 12381726]
Mouse(104130) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11
Rat(299310) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11
naked mole-rat(101715592) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
sheep(101117734) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
Zebrafish(562219) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11
cow(404161) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
domestic cat(101097623) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
dog(480894) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019056 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019056 Rosetta Predictions human pricing
NM_001106756 Rosetta Predictions rat pricing
NM_019435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352636 predicted 620
2 SASI_Hs01_00014513 predicted 525
3 SASI_Hs01_00014514 predicted 607
4 SASI_Hs01_00014515 predicted 526
5 SASI_Hs02_00352637 predicted 656
6 SASI_Hs01_00014516 predicted 609
7 SASI_Hs01_00014517 predicted 569
8 SASI_Hs01_00014518 predicted 666
9 SASI_Hs01_00014519 predicted 671
10 SASI_Hs01_00014520 predicted 567
11 SASI_Hs01_00014521 predicted 688
12 SASI_Hs01_00014522 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222088 predicted 516
2 SASI_Rn02_00222089 predicted 612
3 SASI_Rn02_00222090 predicted 499
4 SASI_Rn02_00222091 predicted 540
5 SASI_Rn02_00222092 predicted 492
6 SASI_Rn02_00222093 predicted 482
7 SASI_Rn02_00222094 predicted 519
8 SASI_Rn02_00222095 predicted 591
9 SASI_Rn02_00222096 predicted 488
10 SASI_Rn02_00222097 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151404 predicted 507
2 SASI_Mm01_00151405 predicted 498
3 SASI_Mm02_00324379 predicted 534
4 SASI_Mm02_00324380 predicted 536
5 SASI_Mm01_00151410 predicted 497
6 SASI_Mm01_00151411 predicted 557
7 SASI_Mm01_00151412 predicted 500
8 SASI_Mm02_00324381 predicted 532
9 SASI_Mm02_00324382 predicted 527
10 SASI_Mm01_00151409 predicted 542
11 SASI_Mm01_00151406 predicted 531
12 SASI_Mm01_00151407 predicted 534
13 SASI_Mm01_00151408 predicted 527
14 SASI_Mm01_00151413 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019435
VALIDATED
NDUFB11 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-661s1c1
Sequence:CCGGAGACTTGTGAAATACCGAGAACTCGAGTTCTCGGTATTTCACAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-502s1c1
Sequence:CCGGCCTGACTTTCATGGTTATGATCTCGAGATCATAACCATGAAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-543s1c1
Sequence:CCGGCTGGAATATGCGAGCTGTCTTCTCGAGAAGACAGCTCGCATATTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019435.2-711s1c1
Sequence:CCGGCTACTTCGATCCCAGCAAGATCTCGAGATCTTGCTGGGATCGAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-618s1c1
Sequence:CCGGGCCTGATTACAGGATGCAAGACTCGAGTCTTGCATCCTGTAATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-718s21c1
Sequence:CCGGCTACTTCGATCCCAGCAAGATCTCGAGATCTTGCTGGGATCGAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-509s21c1
Sequence:CCGGCCTGACTTTCATGGTTATGATCTCGAGATCATAACCATGAAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-625s21c1
Sequence:CCGGGCCTGATTACAGGATGCAAGACTCGAGTCTTGCATCCTGTAATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-550s21c1
Sequence:CCGGCTGGAATATGCGAGCTGTCTTCTCGAGAAGACAGCTCGCATATTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-668s21c1
Sequence:CCGGAGACTTGTGAAATACCGAGAACTCGAGTTCTCGGTATTTCACAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019435
VALIDATED
NDUFB11 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-661s1c1
Sequence:CCGGAGACTTGTGAAATACCGAGAACTCGAGTTCTCGGTATTTCACAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-502s1c1
Sequence:CCGGCCTGACTTTCATGGTTATGATCTCGAGATCATAACCATGAAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-543s1c1
Sequence:CCGGCTGGAATATGCGAGCTGTCTTCTCGAGAAGACAGCTCGCATATTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019435.2-711s1c1
Sequence:CCGGCTACTTCGATCCCAGCAAGATCTCGAGATCTTGCTGGGATCGAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-618s1c1
Sequence:CCGGGCCTGATTACAGGATGCAAGACTCGAGTCTTGCATCCTGTAATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-718s21c1
Sequence:CCGGCTACTTCGATCCCAGCAAGATCTCGAGATCTTGCTGGGATCGAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-509s21c1
Sequence:CCGGCCTGACTTTCATGGTTATGATCTCGAGATCATAACCATGAAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-625s21c1
Sequence:CCGGGCCTGATTACAGGATGCAAGACTCGAGTCTTGCATCCTGTAATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-550s21c1
Sequence:CCGGCTGGAATATGCGAGCTGTCTTCTCGAGAAGACAGCTCGCATATTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-668s21c1
Sequence:CCGGAGACTTGTGAAATACCGAGAACTCGAGTTCTCGGTATTTCACAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019435
VALIDATED
NDUFB11 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-661s1c1
Sequence:CCGGAGACTTGTGAAATACCGAGAACTCGAGTTCTCGGTATTTCACAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-502s1c1
Sequence:CCGGCCTGACTTTCATGGTTATGATCTCGAGATCATAACCATGAAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-543s1c1
Sequence:CCGGCTGGAATATGCGAGCTGTCTTCTCGAGAAGACAGCTCGCATATTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019435.2-711s1c1
Sequence:CCGGCTACTTCGATCCCAGCAAGATCTCGAGATCTTGCTGGGATCGAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019435.2-618s1c1
Sequence:CCGGGCCTGATTACAGGATGCAAGACTCGAGTCTTGCATCCTGTAATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-718s21c1
Sequence:CCGGCTACTTCGATCCCAGCAAGATCTCGAGATCTTGCTGGGATCGAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-509s21c1
Sequence:CCGGCCTGACTTTCATGGTTATGATCTCGAGATCATAACCATGAAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-625s21c1
Sequence:CCGGGCCTGATTACAGGATGCAAGACTCGAGTCTTGCATCCTGTAATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-550s21c1
Sequence:CCGGCTGGAATATGCGAGCTGTCTTCTCGAGAAGACAGCTCGCATATTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019435.4-668s21c1
Sequence:CCGGAGACTTGTGAAATACCGAGAACTCGAGTTCTCGGTATTTCACAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019056
VALIDATED
NDUFB11 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019056.2-799s1c1
Sequence:CCGGCATCATGGAATCCAACTGCTTCTCGAGAAGCAGTTGGATTCCATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-622s1c1
Sequence:CCGGCATGCGACTTGTCTTCTTCTTCTCGAGAAGAAGAAGACAAGTCGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-438s1c1
Sequence:CCGGCCCGCGTCCGCTGGGAATCTACTCGAGTAGATTCCCAGCGGACGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-634s1c1
Sequence:CCGGCTTCTTCTTTGGCGTCTCCATCTCGAGATGGAGACGCCAAAGAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-616s1c1
Sequence:CCGGCTGGAACATGCGACTTGTCTTCTCGAGAAGACAAGTCGCATGTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019056
VALIDATED
NDUFB11 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019056.2-799s1c1
Sequence:CCGGCATCATGGAATCCAACTGCTTCTCGAGAAGCAGTTGGATTCCATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-622s1c1
Sequence:CCGGCATGCGACTTGTCTTCTTCTTCTCGAGAAGAAGAAGACAAGTCGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-438s1c1
Sequence:CCGGCCCGCGTCCGCTGGGAATCTACTCGAGTAGATTCCCAGCGGACGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-634s1c1
Sequence:CCGGCTTCTTCTTTGGCGTCTCCATCTCGAGATGGAGACGCCAAAGAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-616s1c1
Sequence:CCGGCTGGAACATGCGACTTGTCTTCTCGAGAAGACAAGTCGCATGTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019056
VALIDATED
NDUFB11 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019056.2-799s1c1
Sequence:CCGGCATCATGGAATCCAACTGCTTCTCGAGAAGCAGTTGGATTCCATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-622s1c1
Sequence:CCGGCATGCGACTTGTCTTCTTCTTCTCGAGAAGAAGAAGACAAGTCGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-438s1c1
Sequence:CCGGCCCGCGTCCGCTGGGAATCTACTCGAGTAGATTCCCAGCGGACGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-634s1c1
Sequence:CCGGCTTCTTCTTTGGCGTCTCCATCTCGAGATGGAGACGCCAAAGAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_019056.2-616s1c1
Sequence:CCGGCTGGAACATGCGACTTGTCTTCTCGAGAAGACAAGTCGCATGTTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)