EMAIL THIS PAGE TO A FRIEND

NDUFB1

NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa

20 Gene Product Result for
Synonyms: CI-MNLL CI-SGDH MNLL
UniProtKB ID: O75438, A0AV68
Gene ID:
Rat(100912357) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1
domestic guinea pig(101789289) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa
naked mole-rat(101726682) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa
sheep(101113437) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa
chicken(423415) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa
cow(327690) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa
domestic cat(101086911) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004545 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122371 MISSION® esiRNA esiRNA human NDUFB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004545 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174179 predicted 325
2 SASI_Hs01_00174180 predicted 213
3 SASI_Hs01_00174181 predicted 222
4 SASI_Hs01_00174182 predicted 354
5 SASI_Hs01_00174183 predicted 269
6 SASI_Hs01_00174184 predicted 275
7 SASI_Hs01_00174185 predicted 171
8 SASI_Hs01_00174186 predicted 274
9 SASI_Hs01_00174188 predicted 177
10 SASI_Hs02_00337857 predicted 160
11 SASI_Hs01_00174187 predicted 331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004545
VALIDATED
NDUFB1 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-164s21c1
Sequence:CCGGTGCAGCTATCATGGTGAACTTCTCGAGAAGTTCACCATGATAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-198s21c1
Sequence:CCGGCGGGACCACTGGGTTCATGTTCTCGAGAACATGAACCCAGTGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-225s21c1
Sequence:CCGGCCTATGGGATTTGTCATTGGACTCGAGTCCAATGACAAATCCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-259s21c1
Sequence:CCGGGAAAGAGTGATGAACGGCTAACTCGAGTTAGCCGTTCATCACTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-259s1c1
Sequence:CCGGGAAAGAGTGATGAACGGCTAACTCGAGTTAGCCGTTCATCACTCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-198s1c1
Sequence:CCGGCGGGACCACTGGGTTCATGTTCTCGAGAACATGAACCCAGTGGTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-173s1c1
Sequence:CCGGCATGGTGAACTTACTTCAGATCTCGAGATCTGAAGTAAGTTCACCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-225s1c1
Sequence:CCGGCCTATGGGATTTGTCATTGGACTCGAGTCCAATGACAAATCCCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-164s1c1
Sequence:CCGGTGCAGCTATCATGGTGAACTTCTCGAGAAGTTCACCATGATAGCTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004545
VALIDATED
NDUFB1 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-164s21c1
Sequence:CCGGTGCAGCTATCATGGTGAACTTCTCGAGAAGTTCACCATGATAGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-198s21c1
Sequence:CCGGCGGGACCACTGGGTTCATGTTCTCGAGAACATGAACCCAGTGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-225s21c1
Sequence:CCGGCCTATGGGATTTGTCATTGGACTCGAGTCCAATGACAAATCCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-259s21c1
Sequence:CCGGGAAAGAGTGATGAACGGCTAACTCGAGTTAGCCGTTCATCACTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-259s1c1
Sequence:CCGGGAAAGAGTGATGAACGGCTAACTCGAGTTAGCCGTTCATCACTCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-198s1c1
Sequence:CCGGCGGGACCACTGGGTTCATGTTCTCGAGAACATGAACCCAGTGGTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-173s1c1
Sequence:CCGGCATGGTGAACTTACTTCAGATCTCGAGATCTGAAGTAAGTTCACCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-225s1c1
Sequence:CCGGCCTATGGGATTTGTCATTGGACTCGAGTCCAATGACAAATCCCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-164s1c1
Sequence:CCGGTGCAGCTATCATGGTGAACTTCTCGAGAAGTTCACCATGATAGCTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004545
VALIDATED
NDUFB1 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-164s21c1
Sequence:CCGGTGCAGCTATCATGGTGAACTTCTCGAGAAGTTCACCATGATAGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-198s21c1
Sequence:CCGGCGGGACCACTGGGTTCATGTTCTCGAGAACATGAACCCAGTGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-225s21c1
Sequence:CCGGCCTATGGGATTTGTCATTGGACTCGAGTCCAATGACAAATCCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004545.3-259s21c1
Sequence:CCGGGAAAGAGTGATGAACGGCTAACTCGAGTTAGCCGTTCATCACTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-259s1c1
Sequence:CCGGGAAAGAGTGATGAACGGCTAACTCGAGTTAGCCGTTCATCACTCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-198s1c1
Sequence:CCGGCGGGACCACTGGGTTCATGTTCTCGAGAACATGAACCCAGTGGTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-173s1c1
Sequence:CCGGCATGGTGAACTTACTTCAGATCTCGAGATCTGAAGTAAGTTCACCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-225s1c1
Sequence:CCGGCCTATGGGATTTGTCATTGGACTCGAGTCCAATGACAAATCCCATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004545.3-164s1c1
Sequence:CCGGTGCAGCTATCATGGTGAACTTCTCGAGAAGTTCACCATGATAGCTGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)