EMAIL THIS PAGE TO A FRIEND

NDUFB2

NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa

44 Gene Product Result for
Synonyms: AGGG CI-AGGG
UniProtKB ID: O95178, Q6FGI6
Gene ID:
Human(4708) Summary: The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It plays a important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Hydropathy analysis revealed that this subunit and 4 other subunits have an overall hydrophilic pattern, even though they are found within the hydrophobic protein (HP) fraction of complex I. [provided by RefSeq, Jul 2008]
Mouse(68198) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2
Rat(362344) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2
chicken(418118) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
cow(327713) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
domestic cat(101082389) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
sheep(101107189) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
naked mole-rat(101702077) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
domestic guinea pig(100718422) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004546 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004546 Rosetta Predictions human pricing
NM_001108624 Rosetta Predictions rat pricing
NM_026612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050424 predicted 216
2 SASI_Hs01_00050425 predicted 213
3 SASI_Hs01_00050426 predicted 246
4 SASI_Hs01_00050427 predicted 229
5 SASI_Hs01_00050428 predicted 249
6 SASI_Hs01_00050429 predicted 245
7 SASI_Hs01_00050430 predicted 233
8 SASI_Hs01_00050431 predicted 218
9 SASI_Hs01_00050432 predicted 221
10 SASI_Hs01_00050433 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240469 predicted 4270
2 SASI_Rn02_00240470 predicted 3766
3 SASI_Rn02_00240471 predicted 4338
4 SASI_Rn02_00240472 predicted 3720
5 SASI_Rn02_00240473 predicted 4300
6 SASI_Rn02_00240474 predicted 3766
7 SASI_Rn02_00240475 predicted 3657
8 SASI_Rn02_00240476 predicted 4075
9 SASI_Rn02_00240477 predicted 3964
10 SASI_Rn02_00240478 predicted 3930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163877 predicted 218
2 SASI_Mm01_00163878 predicted 198
3 SASI_Mm01_00163879 predicted 210
4 SASI_Mm01_00163880 predicted 220
5 SASI_Mm01_00163881 predicted 201
6 SASI_Mm01_00163882 predicted 217
7 SASI_Mm01_00163884 predicted 199
8 SASI_Mm01_00163885 predicted 225
9 SASI_Mm01_00163886 predicted 228
10 SASI_Mm02_00330576 predicted 371
11 SASI_Mm01_00163883 predicted 199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004546
VALIDATED
NDUFB2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-211s1c1
Sequence:CCGGGCTGACCAGATCCCAGGTGTTCTCGAGAACACCTGGGATCTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-333s1c1
Sequence:CCGGCCCAGTGGACAGATGAAGAATCTCGAGATTCTTCATCTGTCCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004546.2-312s1c1
Sequence:CCGGACTTTCCGTATCCTGATCCTTCTCGAGAAGGATCAGGATACGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-223s1c1
Sequence:CCGGCCAGGTGTTCCAGAGCGAGTTCTCGAGAACTCGCTCTGGAACACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-350s1c1
Sequence:CCGGGAATTAGGTATCCCTCCTGATCTCGAGATCAGGAGGGATACCTAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004546
VALIDATED
NDUFB2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-211s1c1
Sequence:CCGGGCTGACCAGATCCCAGGTGTTCTCGAGAACACCTGGGATCTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-333s1c1
Sequence:CCGGCCCAGTGGACAGATGAAGAATCTCGAGATTCTTCATCTGTCCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004546.2-312s1c1
Sequence:CCGGACTTTCCGTATCCTGATCCTTCTCGAGAAGGATCAGGATACGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-223s1c1
Sequence:CCGGCCAGGTGTTCCAGAGCGAGTTCTCGAGAACTCGCTCTGGAACACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-350s1c1
Sequence:CCGGGAATTAGGTATCCCTCCTGATCTCGAGATCAGGAGGGATACCTAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004546
VALIDATED
NDUFB2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-211s1c1
Sequence:CCGGGCTGACCAGATCCCAGGTGTTCTCGAGAACACCTGGGATCTGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-333s1c1
Sequence:CCGGCCCAGTGGACAGATGAAGAATCTCGAGATTCTTCATCTGTCCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004546.2-312s1c1
Sequence:CCGGACTTTCCGTATCCTGATCCTTCTCGAGAAGGATCAGGATACGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-223s1c1
Sequence:CCGGCCAGGTGTTCCAGAGCGAGTTCTCGAGAACTCGCTCTGGAACACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004546.2-350s1c1
Sequence:CCGGGAATTAGGTATCCCTCCTGATCTCGAGATCAGGAGGGATACCTAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026612
VALIDATED
NDUFB2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-211s1c1
Sequence:CCGGTGAGTTCTTAAGCTCACTCATCTCGAGATGAGTGAGCTTAAGAACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-108s21c1
Sequence:CCGGGCTGGAGACAGTGGAGTCCGTCTCGAGACGGACTCCACTGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-235s1c1
Sequence:CCGGGTTCTGGATTCTTTGGCGATTCTCGAGAATCGCCAAAGAATCCAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-228s1c1
Sequence:CCGGTCATGTGGTTCTGGATTCTTTCTCGAGAAAGAATCCAGAACCACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-113s1c1
Sequence:CCGGGCTGGAGACAGTGGAGTCCGTCTCGAGACGGACTCCACTGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-291s1c1
Sequence:CCGGCATATCCAGATCCTTCACAGTCTCGAGACTGTGAAGGATCTGGATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-264s21c1
Sequence:CCGGGATGCTGTGCTGGGTCACTTTCTCGAGAAAGTGACCCAGCACAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-286s21c1
Sequence:CCGGCATATCCAGATCCTTCACAGTCTCGAGACTGTGAAGGATCTGGATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-133s21c1
Sequence:CCGGCTGGCGGTGGTGTACATATTCCTCGAGGAATATGTACACCACCGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-230s21c1
Sequence:CCGGGTTCTGGATTCTTTGGCGATTCTCGAGAATCGCCAAAGAATCCAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026612
VALIDATED
NDUFB2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-211s1c1
Sequence:CCGGTGAGTTCTTAAGCTCACTCATCTCGAGATGAGTGAGCTTAAGAACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-108s21c1
Sequence:CCGGGCTGGAGACAGTGGAGTCCGTCTCGAGACGGACTCCACTGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-235s1c1
Sequence:CCGGGTTCTGGATTCTTTGGCGATTCTCGAGAATCGCCAAAGAATCCAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-228s1c1
Sequence:CCGGTCATGTGGTTCTGGATTCTTTCTCGAGAAAGAATCCAGAACCACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-113s1c1
Sequence:CCGGGCTGGAGACAGTGGAGTCCGTCTCGAGACGGACTCCACTGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-291s1c1
Sequence:CCGGCATATCCAGATCCTTCACAGTCTCGAGACTGTGAAGGATCTGGATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-264s21c1
Sequence:CCGGGATGCTGTGCTGGGTCACTTTCTCGAGAAAGTGACCCAGCACAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-286s21c1
Sequence:CCGGCATATCCAGATCCTTCACAGTCTCGAGACTGTGAAGGATCTGGATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-133s21c1
Sequence:CCGGCTGGCGGTGGTGTACATATTCCTCGAGGAATATGTACACCACCGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-230s21c1
Sequence:CCGGGTTCTGGATTCTTTGGCGATTCTCGAGAATCGCCAAAGAATCCAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026612
VALIDATED
NDUFB2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-211s1c1
Sequence:CCGGTGAGTTCTTAAGCTCACTCATCTCGAGATGAGTGAGCTTAAGAACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-108s21c1
Sequence:CCGGGCTGGAGACAGTGGAGTCCGTCTCGAGACGGACTCCACTGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-235s1c1
Sequence:CCGGGTTCTGGATTCTTTGGCGATTCTCGAGAATCGCCAAAGAATCCAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-228s1c1
Sequence:CCGGTCATGTGGTTCTGGATTCTTTCTCGAGAAAGAATCCAGAACCACATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-113s1c1
Sequence:CCGGGCTGGAGACAGTGGAGTCCGTCTCGAGACGGACTCCACTGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026612.1-291s1c1
Sequence:CCGGCATATCCAGATCCTTCACAGTCTCGAGACTGTGAAGGATCTGGATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-264s21c1
Sequence:CCGGGATGCTGTGCTGGGTCACTTTCTCGAGAAAGTGACCCAGCACAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-286s21c1
Sequence:CCGGCATATCCAGATCCTTCACAGTCTCGAGACTGTGAAGGATCTGGATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-133s21c1
Sequence:CCGGCTGGCGGTGGTGTACATATTCCTCGAGGAATATGTACACCACCGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026612.3-230s21c1
Sequence:CCGGGTTCTGGATTCTTTGGCGATTCTCGAGAATCGCCAAAGAATCCAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)