EMAIL THIS PAGE TO A FRIEND

NDUFB5

NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa

84 Gene Product Result for
Synonyms: CISGDH SGDH
UniProtKB ID: O43674, Q561V6
Gene ID:
Human(4711) Summary: The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(66046) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5
Rat(294964) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5
Zebrafish(797063) NADH dehydrogenase (ubiquinone) 1 beta subcomplex 5
cow(338061) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
domestic cat(101090177) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
dog(478639) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
chicken(424978) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
domestic guinea pig(100725644) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
naked mole-rat(101716995) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
sheep(101108008) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA005640 Anti-NDUFB5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
AV45318 Anti-NDUFB5 antibody produced in rabbit affinity isolated antibody guinea pig, rat, rabbit, bovine, human, horse, mouse
western blot pricing
SAB2702060 Anti-NDUFB5 antibody produced in rabbit human, mouse, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
WH0004711M1 Monoclonal Anti-NDUFB5 antibody produced in mouse clone 5G5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025316 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025316 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025316 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002492 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002492 Rosetta Predictions human pricing
NM_001106426 Rosetta Predictions rat pricing
NM_025316 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333943 predicted 386
2 SASI_Hs01_00088744 predicted 389
3 SASI_Hs01_00088745 predicted 347
4 SASI_Hs01_00088746 predicted 255
5 SASI_Hs01_00088748 predicted 343
6 SASI_Hs01_00088749 predicted 381
7 SASI_Hs01_00088750 predicted 204
8 SASI_Hs02_00333944 predicted 382
9 SASI_Hs02_00333945 predicted 350
10 SASI_Hs01_00088751 predicted 374
11 SASI_Hs01_00088747 predicted 359
12 SASI_Hs01_00088752 predicted 393
13 SASI_Hs01_00088753 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218848 predicted 425
2 SASI_Rn02_00218849 predicted 235
3 SASI_Rn02_00218850 predicted 604
4 SASI_Rn02_00218851 predicted 412
5 SASI_Rn02_00218852 predicted 701
6 SASI_Rn02_00218853 predicted 816
7 SASI_Rn02_00218854 predicted 778
8 SASI_Rn02_00218855 predicted 318
9 SASI_Rn02_00218856 predicted 226
10 SASI_Rn02_00218857 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054586 predicted 368
2 SASI_Mm01_00054587 predicted 330
3 SASI_Mm01_00054588 predicted 342
4 SASI_Mm01_00054590 predicted 266
5 SASI_Mm01_00054591 predicted 266
6 SASI_Mm01_00054592 predicted 743
7 SASI_Mm02_00327952 predicted 730
8 SASI_Mm02_00327953 predicted 727
9 SASI_Mm01_00054594 predicted 738
10 SASI_Mm02_00327954 predicted 717
11 SASI_Mm01_00054589 predicted 548
12 SASI_Mm01_00054593 predicted 579
13 SASI_Mm01_00054595 predicted 578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025316
VALIDATED
NDUFB5 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025316.2-211s1c1
Sequence:CCGGCGCTCGCTTCTTGAGGTTAATCTCGAGATTAACCTCAAGAAGCGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025316.2-350s1c1
Sequence:CCGGGAGTATTACAAGCATCCGATACTCGAGTATCGGATGCTTGTAATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025316.2-238s1c1
Sequence:CCGGCTACCTTATGTTGACTGGGATCTCGAGATCCCAGTCAACATAAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025316.2-337s1c1
Sequence:CCGGCCCTGAACACTGGGAGTATTACTCGAGTAATACTCCCAGTGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025316.2-435s1c1
Sequence:CCGGTCCTCCAGATTGAATCTGAAACTCGAGTTTCAGATTCAATCTGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025316.2-745s21c1
Sequence:CCGGTGGGATTTACAGGGTAGTAATCTCGAGATTACTACCCTGTAAATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025316.2-350s21c1
Sequence:CCGGGAGTATTACAAGCATCCGATACTCGAGTATCGGATGCTTGTAATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025316.2-211s21c1
Sequence:CCGGCGCTCGCTTCTTGAGGTTAATCTCGAGATTAACCTCAAGAAGCGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025316.2-435s21c1
Sequence:CCGGTCCTCCAGATTGAATCTGAAACTCGAGTTTCAGATTCAATCTGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025316
VALIDATED
NDUFB5 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025316.2-211s1c1
Sequence:CCGGCGCTCGCTTCTTGAGGTTAATCTCGAGATTAACCTCAAGAAGCGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025316.2-350s1c1
Sequence:CCGGGAGTATTACAAGCATCCGATACTCGAGTATCGGATGCTTGTAATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025316.2-238s1c1
Sequence:CCGGCTACCTTATGTTGACTGGGATCTCGAGATCCCAGTCAACATAAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025316.2-337s1c1
Sequence:CCGGCCCTGAACACTGGGAGTATTACTCGAGTAATACTCCCAGTGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025316.2-435s1c1
Sequence:CCGGTCCTCCAGATTGAATCTGAAACTCGAGTTTCAGATTCAATCTGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025316.2-745s21c1
Sequence:CCGGTGGGATTTACAGGGTAGTAATCTCGAGATTACTACCCTGTAAATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025316.2-350s21c1
Sequence:CCGGGAGTATTACAAGCATCCGATACTCGAGTATCGGATGCTTGTAATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025316.2-211s21c1
Sequence:CCGGCGCTCGCTTCTTGAGGTTAATCTCGAGATTAACCTCAAGAAGCGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025316.2-435s21c1
Sequence:CCGGTCCTCCAGATTGAATCTGAAACTCGAGTTTCAGATTCAATCTGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025316
VALIDATED
NDUFB5 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025316.2-211s1c1
Sequence:CCGGCGCTCGCTTCTTGAGGTTAATCTCGAGATTAACCTCAAGAAGCGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025316.2-350s1c1
Sequence:CCGGGAGTATTACAAGCATCCGATACTCGAGTATCGGATGCTTGTAATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025316.2-238s1c1
Sequence:CCGGCTACCTTATGTTGACTGGGATCTCGAGATCCCAGTCAACATAAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025316.2-337s1c1
Sequence:CCGGCCCTGAACACTGGGAGTATTACTCGAGTAATACTCCCAGTGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025316.2-435s1c1
Sequence:CCGGTCCTCCAGATTGAATCTGAAACTCGAGTTTCAGATTCAATCTGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025316.2-745s21c1
Sequence:CCGGTGGGATTTACAGGGTAGTAATCTCGAGATTACTACCCTGTAAATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025316.2-350s21c1
Sequence:CCGGGAGTATTACAAGCATCCGATACTCGAGTATCGGATGCTTGTAATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025316.2-211s21c1
Sequence:CCGGCGCTCGCTTCTTGAGGTTAATCTCGAGATTAACCTCAAGAAGCGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025316.2-435s21c1
Sequence:CCGGTCCTCCAGATTGAATCTGAAACTCGAGTTTCAGATTCAATCTGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002492
VALIDATED
NDUFB5 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002492.2-310s1c1
Sequence:CCGGGTCAAGCTGAACTAGCAGAAACTCGAGTTTCTGCTAGTTCAGCTTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002492.2-429s1c1
Sequence:CCGGGAAAGAACAATGGCCGTCCTTCTCGAGAAGGACGGCCATTGTTCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002492.2-208s1c1
Sequence:CCGGCTAGATTCTATGACAGGCGTTCTCGAGAACGCCTGTCATAGAATCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002492.2-577s1c1
Sequence:CCGGCGAAAGCAACTCCTGACAATTCTCGAGAATTGTCAGGAGTTGCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002492.2-371s1c1
Sequence:CCGGGCATCCCATATCAAGATGGATCTCGAGATCCATCTTGATATGGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-523s21c1
Sequence:CCGGATGGACCCTGGTATTACTATGCTCGAGCATAGTAATACCAGGGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-577s21c1
Sequence:CCGGCGAAAGCAACTCCTGACAATTCTCGAGAATTGTCAGGAGTTGCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002492.2-310s21c1
Sequence:CCGGGTCAAGCTGAACTAGCAGAAACTCGAGTTTCTGCTAGTTCAGCTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-371s21c1
Sequence:CCGGGCATCCCATATCAAGATGGATCTCGAGATCCATCTTGATATGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-893s21c1
Sequence:CCGGTAATGTTAAGCACCAGTAATTCTCGAGAATTACTGGTGCTTAACATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002492
VALIDATED
NDUFB5 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002492.2-310s1c1
Sequence:CCGGGTCAAGCTGAACTAGCAGAAACTCGAGTTTCTGCTAGTTCAGCTTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002492.2-429s1c1
Sequence:CCGGGAAAGAACAATGGCCGTCCTTCTCGAGAAGGACGGCCATTGTTCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002492.2-208s1c1
Sequence:CCGGCTAGATTCTATGACAGGCGTTCTCGAGAACGCCTGTCATAGAATCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002492.2-577s1c1
Sequence:CCGGCGAAAGCAACTCCTGACAATTCTCGAGAATTGTCAGGAGTTGCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002492.2-371s1c1
Sequence:CCGGGCATCCCATATCAAGATGGATCTCGAGATCCATCTTGATATGGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-523s21c1
Sequence:CCGGATGGACCCTGGTATTACTATGCTCGAGCATAGTAATACCAGGGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-577s21c1
Sequence:CCGGCGAAAGCAACTCCTGACAATTCTCGAGAATTGTCAGGAGTTGCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002492.2-310s21c1
Sequence:CCGGGTCAAGCTGAACTAGCAGAAACTCGAGTTTCTGCTAGTTCAGCTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-371s21c1
Sequence:CCGGGCATCCCATATCAAGATGGATCTCGAGATCCATCTTGATATGGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-893s21c1
Sequence:CCGGTAATGTTAAGCACCAGTAATTCTCGAGAATTACTGGTGCTTAACATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002492
VALIDATED
NDUFB5 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002492.2-310s1c1
Sequence:CCGGGTCAAGCTGAACTAGCAGAAACTCGAGTTTCTGCTAGTTCAGCTTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002492.2-429s1c1
Sequence:CCGGGAAAGAACAATGGCCGTCCTTCTCGAGAAGGACGGCCATTGTTCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002492.2-208s1c1
Sequence:CCGGCTAGATTCTATGACAGGCGTTCTCGAGAACGCCTGTCATAGAATCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002492.2-577s1c1
Sequence:CCGGCGAAAGCAACTCCTGACAATTCTCGAGAATTGTCAGGAGTTGCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002492.2-371s1c1
Sequence:CCGGGCATCCCATATCAAGATGGATCTCGAGATCCATCTTGATATGGGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-523s21c1
Sequence:CCGGATGGACCCTGGTATTACTATGCTCGAGCATAGTAATACCAGGGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-577s21c1
Sequence:CCGGCGAAAGCAACTCCTGACAATTCTCGAGAATTGTCAGGAGTTGCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002492.2-310s21c1
Sequence:CCGGGTCAAGCTGAACTAGCAGAAACTCGAGTTTCTGCTAGTTCAGCTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-371s21c1
Sequence:CCGGGCATCCCATATCAAGATGGATCTCGAGATCCATCTTGATATGGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002492.2-893s21c1
Sequence:CCGGTAATGTTAAGCACCAGTAATTCTCGAGAATTACTGGTGCTTAACATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)