EMAIL THIS PAGE TO A FRIEND

NDUFB7

NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa

46 Gene Product Result for
Synonyms: B18 CI-B18
UniProtKB ID: P17568, Q6ICN9, Q9UI16
Gene ID:
Human(4713) Summary: The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It is located at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. [provided by RefSeq, Jul 2008]
Mouse(66916) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7
Rat(361385) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7
Zebrafish(393821) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7
cow(338065) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
domestic cat(101091850) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
dog(476686) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
domestic guinea pig(100720197) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
naked mole-rat(101716634) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
sheep(101121851) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004146 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004146 Rosetta Predictions human pricing
NM_001108442 Rosetta Predictions rat pricing
NM_025843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121717 predicted 265
2 SASI_Hs01_00121718 predicted 205
3 SASI_Hs01_00121719 predicted 267
4 SASI_Hs01_00121721 predicted 233
5 SASI_Hs01_00121722 predicted 319
6 SASI_Hs01_00121723 predicted 257
7 SASI_Hs01_00121720 predicted 232
8 SASI_Hs01_00121724 predicted 298
9 SASI_Hs01_00121725 predicted 504
10 SASI_Hs01_00121726 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238679 predicted 231
2 SASI_Rn02_00238680 predicted 272
3 SASI_Rn02_00238681 predicted 272
4 SASI_Rn02_00238682 predicted 305
5 SASI_Rn02_00238683 predicted 247
6 SASI_Rn02_00238684 predicted 289
7 SASI_Rn02_00238685 predicted 261
8 SASI_Rn02_00238686 predicted 196
9 SASI_Rn02_00238687 predicted 272
10 SASI_Rn02_00238688 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088773 predicted 255
2 SASI_Mm01_00088774 predicted 236
3 SASI_Mm01_00088775 predicted 309
4 SASI_Mm01_00088776 predicted 220
5 SASI_Mm01_00088777 predicted 216
6 SASI_Mm01_00088778 predicted 257
7 SASI_Mm02_00329123 predicted 304
8 SASI_Mm01_00088779 predicted 276
9 SASI_Mm01_00088780 predicted 229
10 SASI_Mm01_00088781 predicted 191
11 SASI_Mm01_00088782 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004146
VALIDATED
NDUFB7 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004146.4-269s1c1
Sequence:CCGGGCTGCTCAAGTGCAAGCGTGACTCGAGTCACGCTTGCACTTGAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004146.4-353s1c1
Sequence:CCGGCGACTATGTGATGCGCATGAACTCGAGTTCATGCGCATCACATAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004146.4-203s1c1
Sequence:CCGGGCAGGAGATGATGGACGCGCACTCGAGTGCGCGTCCATCATCTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-203s21c1
Sequence:CCGGGCAGGAGATGATGGACGCGCACTCGAGTGCGCGTCCATCATCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-269s21c1
Sequence:CCGGGCTGCTCAAGTGCAAGCGTGACTCGAGTCACGCTTGCACTTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-353s21c1
Sequence:CCGGCGACTATGTGATGCGCATGAACTCGAGTTCATGCGCATCACATAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-329s21c1
Sequence:CCGGCGACTGGGACTACTGCGAGCACTCGAGTGCTCGCAGTAGTCCCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004146
VALIDATED
NDUFB7 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004146.4-269s1c1
Sequence:CCGGGCTGCTCAAGTGCAAGCGTGACTCGAGTCACGCTTGCACTTGAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004146.4-353s1c1
Sequence:CCGGCGACTATGTGATGCGCATGAACTCGAGTTCATGCGCATCACATAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004146.4-203s1c1
Sequence:CCGGGCAGGAGATGATGGACGCGCACTCGAGTGCGCGTCCATCATCTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-203s21c1
Sequence:CCGGGCAGGAGATGATGGACGCGCACTCGAGTGCGCGTCCATCATCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-269s21c1
Sequence:CCGGGCTGCTCAAGTGCAAGCGTGACTCGAGTCACGCTTGCACTTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-353s21c1
Sequence:CCGGCGACTATGTGATGCGCATGAACTCGAGTTCATGCGCATCACATAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-329s21c1
Sequence:CCGGCGACTGGGACTACTGCGAGCACTCGAGTGCTCGCAGTAGTCCCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004146
VALIDATED
NDUFB7 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004146.4-269s1c1
Sequence:CCGGGCTGCTCAAGTGCAAGCGTGACTCGAGTCACGCTTGCACTTGAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004146.4-353s1c1
Sequence:CCGGCGACTATGTGATGCGCATGAACTCGAGTTCATGCGCATCACATAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004146.4-203s1c1
Sequence:CCGGGCAGGAGATGATGGACGCGCACTCGAGTGCGCGTCCATCATCTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-203s21c1
Sequence:CCGGGCAGGAGATGATGGACGCGCACTCGAGTGCGCGTCCATCATCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-269s21c1
Sequence:CCGGGCTGCTCAAGTGCAAGCGTGACTCGAGTCACGCTTGCACTTGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-353s21c1
Sequence:CCGGCGACTATGTGATGCGCATGAACTCGAGTTCATGCGCATCACATAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004146.4-329s21c1
Sequence:CCGGCGACTGGGACTACTGCGAGCACTCGAGTGCTCGCAGTAGTCCCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025843
VALIDATED
NDUFB7 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-338s1c1
Sequence:CCGGCCTGGATTACGTGAAACGCATCTCGAGATGCGTTTCACGTAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025843.1-186s1c1
Sequence:CCGGACACAACAAGAGATGATGGATCTCGAGATCCATCATCTCTTGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-348s1c1
Sequence:CCGGGTGAAACGCATGAAGGAGTTTCTCGAGAAACTCCTTCATGCGTTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-117s1c1
Sequence:CCGGCCCGAGAAGATACCCAGCTTCCTCGAGGAAGCTGGGTATCTTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-227s1c1
Sequence:CCGGACGTGACTACTGTGCCCACTACTCGAGTAGTGGGCACAGTAGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025843
VALIDATED
NDUFB7 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-338s1c1
Sequence:CCGGCCTGGATTACGTGAAACGCATCTCGAGATGCGTTTCACGTAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025843.1-186s1c1
Sequence:CCGGACACAACAAGAGATGATGGATCTCGAGATCCATCATCTCTTGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-348s1c1
Sequence:CCGGGTGAAACGCATGAAGGAGTTTCTCGAGAAACTCCTTCATGCGTTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-117s1c1
Sequence:CCGGCCCGAGAAGATACCCAGCTTCCTCGAGGAAGCTGGGTATCTTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-227s1c1
Sequence:CCGGACGTGACTACTGTGCCCACTACTCGAGTAGTGGGCACAGTAGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025843
VALIDATED
NDUFB7 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-338s1c1
Sequence:CCGGCCTGGATTACGTGAAACGCATCTCGAGATGCGTTTCACGTAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025843.1-186s1c1
Sequence:CCGGACACAACAAGAGATGATGGATCTCGAGATCCATCATCTCTTGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-348s1c1
Sequence:CCGGGTGAAACGCATGAAGGAGTTTCTCGAGAAACTCCTTCATGCGTTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-117s1c1
Sequence:CCGGCCCGAGAAGATACCCAGCTTCCTCGAGGAAGCTGGGTATCTTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025843.1-227s1c1
Sequence:CCGGACGTGACTACTGTGCCCACTACTCGAGTAGTGGGCACAGTAGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)