EMAIL THIS PAGE TO A FRIEND

NDUFB8

NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa

56 Gene Product Result for
Synonyms: ASHI CI-ASHI
UniProtKB ID: O95169, A8K0L4, Q5W144, Q9UG53, Q9UJR4, Q9UQF3
Gene ID:
Mouse(67264) NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8
Rat(293991) NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8
Goat(100861349) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
sheep(100415906) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
naked mole-rat(101715438) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
domestic guinea pig(100715064) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
Zebrafish(393829) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8
chicken(423763) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
cow(282517) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
domestic cat(101091655) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
dog(477798) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005004 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005004 Rosetta Predictions human pricing
NM_001106360 Rosetta Predictions rat pricing
NM_026061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049514 predicted 278
2 SASI_Hs02_00338754 predicted 424
3 SASI_Hs02_00338755 predicted 430
4 SASI_Hs01_00049516 predicted 335
5 SASI_Hs01_00049517 predicted 399
6 SASI_Hs01_00049519 predicted 203
7 SASI_Hs01_00049520 predicted 344
8 SASI_Hs02_00338756 predicted 429
9 SASI_Hs01_00049521 predicted 365
10 SASI_Hs01_00049523 predicted 246
11 SASI_Hs01_00049515 predicted 425
12 SASI_Hs01_00049518 predicted 428
13 SASI_Hs01_00049522 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218208 predicted 377
2 SASI_Rn02_00218209 predicted 369
3 SASI_Rn02_00218210 predicted 386
4 SASI_Rn02_00218211 predicted 410
5 SASI_Rn02_00218212 predicted 312
6 SASI_Rn02_00218213 predicted 343
7 SASI_Rn02_00218214 predicted 268
8 SASI_Rn02_00218215 predicted 380
9 SASI_Rn02_00218216 predicted 324
10 SASI_Rn02_00218217 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182562 predicted 331
2 SASI_Mm01_00182564 predicted 329
3 SASI_Mm01_00182565 predicted 330
4 SASI_Mm01_00182561 predicted 379
5 SASI_Mm02_00329597 predicted 317
6 SASI_Mm02_00329598 predicted 408
7 SASI_Mm01_00182563 predicted 276
8 SASI_Mm02_00329599 predicted 323
9 SASI_Mm02_00329600 predicted 349
10 SASI_Mm02_00329601 predicted 323
11 SASI_Mm01_00182560 predicted 385
12 SASI_Mm01_00182566 predicted 297
13 SASI_Mm01_00182567 predicted 387
14 SASI_Mm01_00182568 predicted 280
15 SASI_Mm01_00182569 predicted 250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026061
VALIDATED
NDUFB8 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-168s21c1
Sequence:CCGGGCCAAGAAGTATAACATGCGACTCGAGTCGCATGTTATACTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-293s21c1
Sequence:CCGGCCACTCAGAACTCAGGATGAACTCGAGTTCATCCTGAGTTCTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-338s21c1
Sequence:CCGGCCTAGACATGTACATCAGGAACTCGAGTTCCTGATGTACATGTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-486s21c1
Sequence:CCGGCCGAAGCAGTACCCTTACAATCTCGAGATTGTAAGGGTACTGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026061.1-101s1c1
Sequence:CCGGCTTCCATATGACCAAGGACATCTCGAGATGTCCTTGGTCATATGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-293s1c1
Sequence:CCGGCCACTCAGAACTCAGGATGAACTCGAGTTCATCCTGAGTTCTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-486s1c1
Sequence:CCGGCCGAAGCAGTACCCTTACAATCTCGAGATTGTAAGGGTACTGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-168s1c1
Sequence:CCGGGCCAAGAAGTATAACATGCGACTCGAGTCGCATGTTATACTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-338s1c1
Sequence:CCGGCCTAGACATGTACATCAGGAACTCGAGTTCCTGATGTACATGTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026061
VALIDATED
NDUFB8 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-168s21c1
Sequence:CCGGGCCAAGAAGTATAACATGCGACTCGAGTCGCATGTTATACTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-293s21c1
Sequence:CCGGCCACTCAGAACTCAGGATGAACTCGAGTTCATCCTGAGTTCTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-338s21c1
Sequence:CCGGCCTAGACATGTACATCAGGAACTCGAGTTCCTGATGTACATGTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-486s21c1
Sequence:CCGGCCGAAGCAGTACCCTTACAATCTCGAGATTGTAAGGGTACTGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026061.1-101s1c1
Sequence:CCGGCTTCCATATGACCAAGGACATCTCGAGATGTCCTTGGTCATATGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-293s1c1
Sequence:CCGGCCACTCAGAACTCAGGATGAACTCGAGTTCATCCTGAGTTCTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-486s1c1
Sequence:CCGGCCGAAGCAGTACCCTTACAATCTCGAGATTGTAAGGGTACTGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-168s1c1
Sequence:CCGGGCCAAGAAGTATAACATGCGACTCGAGTCGCATGTTATACTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-338s1c1
Sequence:CCGGCCTAGACATGTACATCAGGAACTCGAGTTCCTGATGTACATGTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026061
VALIDATED
NDUFB8 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-168s21c1
Sequence:CCGGGCCAAGAAGTATAACATGCGACTCGAGTCGCATGTTATACTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-293s21c1
Sequence:CCGGCCACTCAGAACTCAGGATGAACTCGAGTTCATCCTGAGTTCTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-338s21c1
Sequence:CCGGCCTAGACATGTACATCAGGAACTCGAGTTCCTGATGTACATGTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026061.2-486s21c1
Sequence:CCGGCCGAAGCAGTACCCTTACAATCTCGAGATTGTAAGGGTACTGCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026061.1-101s1c1
Sequence:CCGGCTTCCATATGACCAAGGACATCTCGAGATGTCCTTGGTCATATGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-293s1c1
Sequence:CCGGCCACTCAGAACTCAGGATGAACTCGAGTTCATCCTGAGTTCTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-486s1c1
Sequence:CCGGCCGAAGCAGTACCCTTACAATCTCGAGATTGTAAGGGTACTGCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-168s1c1
Sequence:CCGGGCCAAGAAGTATAACATGCGACTCGAGTCGCATGTTATACTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026061.1-338s1c1
Sequence:CCGGCCTAGACATGTACATCAGGAACTCGAGTTCCTGATGTACATGTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005004
VALIDATED
NDUFB8 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005004.1-196s1c1
Sequence:CCGGTGTGGAAGACTACGAACCTTACTCGAGTAAGGTTCGTAGTCTTCCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005004.1-430s1c1
Sequence:CCGGCCTGGCTTTCATGATATTCATCTCGAGATGAATATCATGAAAGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005004.1-494s1c1
Sequence:CCGGCCAAAGCAGTATCCTTACAATCTCGAGATTGTAAGGATACTGCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005004.1-346s1c1
Sequence:CCGGCCTAGACATGTACAACAGGAACTCGAGTTCCTGTTGTACATGTCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005004.1-176s1c1
Sequence:CCGGGCCAAGAAGTATAATATGCGTCTCGAGACGCATATTATACTTCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005004
VALIDATED
NDUFB8 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005004.1-196s1c1
Sequence:CCGGTGTGGAAGACTACGAACCTTACTCGAGTAAGGTTCGTAGTCTTCCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005004.1-430s1c1
Sequence:CCGGCCTGGCTTTCATGATATTCATCTCGAGATGAATATCATGAAAGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005004.1-494s1c1
Sequence:CCGGCCAAAGCAGTATCCTTACAATCTCGAGATTGTAAGGATACTGCTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005004.1-346s1c1
Sequence:CCGGCCTAGACATGTACAACAGGAACTCGAGTTCCTGTTGTACATGTCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005004.1-176s1c1
Sequence:CCGGGCCAAGAAGTATAATATGCGTCTCGAGACGCATATTATACTTCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005004
VALIDATED
NDUFB8 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005004.1-196s1c1
Sequence:CCGGTGTGGAAGACTACGAACCTTACTCGAGTAAGGTTCGTAGTCTTCCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005004.1-430s1c1
Sequence:CCGGCCTGGCTTTCATGATATTCATCTCGAGATGAATATCATGAAAGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005004.1-494s1c1
Sequence:CCGGCCAAAGCAGTATCCTTACAATCTCGAGATTGTAAGGATACTGCTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005004.1-346s1c1
Sequence:CCGGCCTAGACATGTACAACAGGAACTCGAGTTCCTGTTGTACATGTCTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005004.1-176s1c1
Sequence:CCGGGCCAAGAAGTATAATATGCGTCTCGAGACGCATATTATACTTCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)