EMAIL THIS PAGE TO A FRIEND

NDUFB9

NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa

49 Gene Product Result for
Synonyms: B22 CI-B22 LYRM3 UQOR22
UniProtKB ID: Q9Y6M9, B2R8M6, Q9UQE8
Gene ID:
Mouse(66218) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9
Rat(299954) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9
Zebrafish(573021) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9
chicken(420337) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
cow(327660) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
domestic cat(101085859) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
dog(475094) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
domestic guinea pig(100725373) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
naked mole-rat(101713987) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
sheep(101106179) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005005 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005005 Rosetta Predictions human pricing
NM_001127294 Rosetta Predictions rat pricing
NM_023172 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166739 predicted 470
2 SASI_Hs01_00166741 predicted 454
3 SASI_Hs01_00166742 predicted 402
4 SASI_Hs01_00166743 predicted 217
5 SASI_Hs01_00166744 predicted 347
6 SASI_Hs01_00166746 predicted 474
7 SASI_Hs02_00338757 predicted 318
8 SASI_Hs02_00338758 predicted 472
9 SASI_Hs02_00338759 predicted 282
10 SASI_Hs01_00166737 predicted 364
11 SASI_Hs01_00166738 predicted 375
12 SASI_Hs01_00166740 predicted 374
13 SASI_Hs01_00166745 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253503 predicted 354
2 SASI_Rn02_00253504 predicted 299
3 SASI_Rn02_00253505 predicted 234
4 SASI_Rn02_00253506 predicted 411
5 SASI_Rn02_00253507 predicted 310
6 SASI_Rn02_00253508 predicted 314
7 SASI_Rn02_00253509 predicted 250
8 SASI_Rn02_00253510 predicted 301
9 SASI_Rn02_00253511 predicted 347
10 SASI_Rn02_00253512 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024982 predicted 313
2 SASI_Mm01_00024983 predicted 323
3 SASI_Mm02_00326893 predicted 249
4 SASI_Mm01_00024984 predicted 260
5 SASI_Mm01_00024985 predicted 321
6 SASI_Mm02_00326894 predicted 318
7 SASI_Mm01_00024986 predicted 365
8 SASI_Mm01_00024987 predicted 356
9 SASI_Mm01_00024988 predicted 308
10 SASI_Mm01_00024990 predicted 416
11 SASI_Mm01_00024989 predicted 352
12 SASI_Mm01_00024991 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005005
VALIDATED
NDUFB9 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-345s1c1
Sequence:CCGGCCTCCTATGAGAGATACGATTCTCGAGAATCGTATCTCTCATAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-545s1c1
Sequence:CCGGCCTGCCCGAAAGGAAGGTGATCTCGAGATCACCTTCCTTTCGGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-216s1c1
Sequence:CCGGCCCGGTTTGAAGAACATAAGACTCGAGTCTTATGTTCTTCAAACCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-175s1c1
Sequence:CCGGCCAGAGAGACAAATACCGATACTCGAGTATCGGTATTTGTCTCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-412s1c1
Sequence:CCGGGAAGGCAATGTATCCTGATTACTCGAGTAATCAGGATACATTGCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-175s21c1
Sequence:CCGGGTGCGTCCAGAGAGACAAATACTCGAGTATTTGTCTCTCTGGACGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-423s21c1
Sequence:CCGGCAATGTATCCTGATTACTTTGCTCGAGCAAAGTAATCAGGATACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-479s21c1
Sequence:CCGGAGCTGGGAACGAGAGGTTAAGCTCGAGCTTAACCTCTCGTTCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-553s21c1
Sequence:CCGGTGCCCGAAAGGAAGGTGATTTCTCGAGAAATCACCTTCCTTTCGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-220s21c1
Sequence:CCGGAGCCCGGTTTGAAGAACATAACTCGAGTTATGTTCTTCAAACCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005005
VALIDATED
NDUFB9 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-345s1c1
Sequence:CCGGCCTCCTATGAGAGATACGATTCTCGAGAATCGTATCTCTCATAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-545s1c1
Sequence:CCGGCCTGCCCGAAAGGAAGGTGATCTCGAGATCACCTTCCTTTCGGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-216s1c1
Sequence:CCGGCCCGGTTTGAAGAACATAAGACTCGAGTCTTATGTTCTTCAAACCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-175s1c1
Sequence:CCGGCCAGAGAGACAAATACCGATACTCGAGTATCGGTATTTGTCTCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-412s1c1
Sequence:CCGGGAAGGCAATGTATCCTGATTACTCGAGTAATCAGGATACATTGCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-175s21c1
Sequence:CCGGGTGCGTCCAGAGAGACAAATACTCGAGTATTTGTCTCTCTGGACGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-423s21c1
Sequence:CCGGCAATGTATCCTGATTACTTTGCTCGAGCAAAGTAATCAGGATACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-479s21c1
Sequence:CCGGAGCTGGGAACGAGAGGTTAAGCTCGAGCTTAACCTCTCGTTCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-553s21c1
Sequence:CCGGTGCCCGAAAGGAAGGTGATTTCTCGAGAAATCACCTTCCTTTCGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-220s21c1
Sequence:CCGGAGCCCGGTTTGAAGAACATAACTCGAGTTATGTTCTTCAAACCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005005
VALIDATED
NDUFB9 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-345s1c1
Sequence:CCGGCCTCCTATGAGAGATACGATTCTCGAGAATCGTATCTCTCATAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-545s1c1
Sequence:CCGGCCTGCCCGAAAGGAAGGTGATCTCGAGATCACCTTCCTTTCGGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-216s1c1
Sequence:CCGGCCCGGTTTGAAGAACATAAGACTCGAGTCTTATGTTCTTCAAACCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-175s1c1
Sequence:CCGGCCAGAGAGACAAATACCGATACTCGAGTATCGGTATTTGTCTCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005005.1-412s1c1
Sequence:CCGGGAAGGCAATGTATCCTGATTACTCGAGTAATCAGGATACATTGCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-175s21c1
Sequence:CCGGGTGCGTCCAGAGAGACAAATACTCGAGTATTTGTCTCTCTGGACGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-423s21c1
Sequence:CCGGCAATGTATCCTGATTACTTTGCTCGAGCAAAGTAATCAGGATACATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-479s21c1
Sequence:CCGGAGCTGGGAACGAGAGGTTAAGCTCGAGCTTAACCTCTCGTTCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-553s21c1
Sequence:CCGGTGCCCGAAAGGAAGGTGATTTCTCGAGAAATCACCTTCCTTTCGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005005.2-220s21c1
Sequence:CCGGAGCCCGGTTTGAAGAACATAACTCGAGTTATGTTCTTCAAACCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023172
VALIDATED
NDUFB9 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-302s1c1
Sequence:CCGGCGAGAGATATGAGTGCTACAACTCGAGTTGTAGCACTCATATCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-167s1c1
Sequence:CCGGCCGGTTTGAAGAACATAAGAACTCGAGTTCTTATGTTCTTCAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-354s1c1
Sequence:CCGGCCCTCTGAGAAAGCAATGTATCTCGAGATACATTGCTTTCTCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-140s1c1
Sequence:CCGGCCGGTACTTTGCTTGCTTGATCTCGAGATCAAGCAAGCAAAGTACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-450s1c1
Sequence:CCGGCAGGAGGAAACATCACCTGATCTCGAGATCAGGTGATGTTTCCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-449s21c1
Sequence:CCGGCAGGAGGAAACATCACCTGATCTCGAGATCAGGTGATGTTTCCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-353s21c1
Sequence:CCGGCCCTCTGAGAAAGCAATGTATCTCGAGATACATTGCTTTCTCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-139s21c1
Sequence:CCGGCCGGTACTTTGCTTGCTTGATCTCGAGATCAAGCAAGCAAAGTACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-166s21c1
Sequence:CCGGCCGGTTTGAAGAACATAAGAACTCGAGTTCTTATGTTCTTCAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-301s21c1
Sequence:CCGGCGAGAGATATGAGTGCTACAACTCGAGTTGTAGCACTCATATCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023172
VALIDATED
NDUFB9 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-302s1c1
Sequence:CCGGCGAGAGATATGAGTGCTACAACTCGAGTTGTAGCACTCATATCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-167s1c1
Sequence:CCGGCCGGTTTGAAGAACATAAGAACTCGAGTTCTTATGTTCTTCAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-354s1c1
Sequence:CCGGCCCTCTGAGAAAGCAATGTATCTCGAGATACATTGCTTTCTCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-140s1c1
Sequence:CCGGCCGGTACTTTGCTTGCTTGATCTCGAGATCAAGCAAGCAAAGTACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-450s1c1
Sequence:CCGGCAGGAGGAAACATCACCTGATCTCGAGATCAGGTGATGTTTCCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-449s21c1
Sequence:CCGGCAGGAGGAAACATCACCTGATCTCGAGATCAGGTGATGTTTCCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-353s21c1
Sequence:CCGGCCCTCTGAGAAAGCAATGTATCTCGAGATACATTGCTTTCTCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-139s21c1
Sequence:CCGGCCGGTACTTTGCTTGCTTGATCTCGAGATCAAGCAAGCAAAGTACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-166s21c1
Sequence:CCGGCCGGTTTGAAGAACATAAGAACTCGAGTTCTTATGTTCTTCAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-301s21c1
Sequence:CCGGCGAGAGATATGAGTGCTACAACTCGAGTTGTAGCACTCATATCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023172
VALIDATED
NDUFB9 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-302s1c1
Sequence:CCGGCGAGAGATATGAGTGCTACAACTCGAGTTGTAGCACTCATATCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-167s1c1
Sequence:CCGGCCGGTTTGAAGAACATAAGAACTCGAGTTCTTATGTTCTTCAAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-354s1c1
Sequence:CCGGCCCTCTGAGAAAGCAATGTATCTCGAGATACATTGCTTTCTCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-140s1c1
Sequence:CCGGCCGGTACTTTGCTTGCTTGATCTCGAGATCAAGCAAGCAAAGTACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023172.2-450s1c1
Sequence:CCGGCAGGAGGAAACATCACCTGATCTCGAGATCAGGTGATGTTTCCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-449s21c1
Sequence:CCGGCAGGAGGAAACATCACCTGATCTCGAGATCAGGTGATGTTTCCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-353s21c1
Sequence:CCGGCCCTCTGAGAAAGCAATGTATCTCGAGATACATTGCTTTCTCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-139s21c1
Sequence:CCGGCCGGTACTTTGCTTGCTTGATCTCGAGATCAAGCAAGCAAAGTACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-166s21c1
Sequence:CCGGCCGGTTTGAAGAACATAAGAACTCGAGTTCTTATGTTCTTCAAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023172.3-301s21c1
Sequence:CCGGCGAGAGATATGAGTGCTACAACTCGAGTTGTAGCACTCATATCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)