EMAIL THIS PAGE TO A FRIEND

NDUFC1

NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa

67 Gene Product Result for
Synonyms: KFYI
UniProtKB ID: O43677, A8K532, Q3MIJ9
Gene ID:
Human(4717) Summary: The encoded protein is a subunit of the NADH:ubiquinone oxidoreductase (complex I), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(66377) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1
Rat(689938) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1
sheep(101116510) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
naked mole-rat(101714309) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
domestic guinea pig(100715632) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
dog(607943) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
domestic cat(101091693) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
cow(282289) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2104604 Anti-NDUFC1 antibody produced in rabbit affinity isolated antibody rat, mouse, rabbit, guinea pig, pig, horse, human, canine, bovine
western blot pricing
HPA044556 Anti-NDUFC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002494 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002494 Rosetta Predictions human pricing
XM_001072602 Rosetta Predictions rat pricing
NM_025523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013840 predicted 165
2 SASI_Hs01_00013841 predicted 217
3 SASI_Hs01_00013842 predicted 290
4 SASI_Hs01_00013844 predicted 163
5 SASI_Hs01_00013845 predicted 144
6 SASI_Hs01_00013846 predicted 245
7 SASI_Hs01_00013847 predicted 295
8 SASI_Hs01_00013848 predicted 260
9 SASI_Hs01_00013849 predicted 262
10 SASI_Hs02_00333947 predicted 136
11 SASI_Hs01_00013843 predicted 125
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339828 predicted 486
2 SASI_Rn02_00339829 predicted 480
3 SASI_Rn02_00339830 predicted 516
4 SASI_Rn02_00339831 predicted 361
5 SASI_Rn02_00339832 predicted 459
6 SASI_Rn02_00339833 predicted 458
7 SASI_Rn02_00339834 predicted 367
8 SASI_Rn02_00339835 predicted 420
9 SASI_Rn02_00339836 predicted 351
10 SASI_Rn02_00339837 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328429 predicted 315
2 SASI_Mm01_00181910 predicted 340
3 SASI_Mm02_00328430 predicted 248
4 SASI_Mm02_00328431 predicted 367
5 SASI_Mm01_00181911 predicted 256
6 SASI_Mm02_00328432 predicted 313
7 SASI_Mm01_00181912 predicted 337
8 SASI_Mm02_00328433 predicted 367
9 SASI_Mm01_00181915 predicted 232
10 SASI_Mm02_00328434 predicted 290
11 SASI_Mm01_00181909 predicted 124
12 SASI_Mm01_00181913 predicted 200
13 SASI_Mm01_00181914 predicted 185
14 SASI_Mm01_00181916 predicted 137
15 SASI_Mm01_00181917 predicted 38
16 SASI_Mm01_00181918 predicted 96
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025523
VALIDATED
NDUFC1 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-125s21c1
Sequence:CCGGCCAGTCAATGCCAAACCTAACCTCGAGGTTAGGTTTGGCATTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-113s21c1
Sequence:CCGGTATGTCCGGGAGCCAGTCAATCTCGAGATTGACTGGCTCCCGGACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-198s21c1
Sequence:CCGGTCATCCAAACACACAATGAAGCTCGAGCTTCATTGTGTGTTTGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-237s21c1
Sequence:CCGGGAAGAAATGGATTGGAATAAACTCGAGTTTATTCCAATCCATTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-96s21c1
Sequence:CCGGCAACACGGTCGAAGTTCTATGCTCGAGCATAGAACTTCGACCGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-197s1c1
Sequence:CCGGCTCATCCAAACACACAATGAACTCGAGTTCATTGTGTGTTTGGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025523.1-91s1c1
Sequence:CCGGCTCTTCAACACGGTCGAAGTTCTCGAGAACTTCGACCGTGTTGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-130s1c1
Sequence:CCGGCAATGCCAAACCTAACTGGTTCTCGAGAACCAGTTAGGTTTGGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-84s1c1
Sequence:CCGGCGAGCTGCTCTTCAACACGGTCTCGAGACCGTGTTGAAGAGCAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-203s1c1
Sequence:CCGGCAAACACACAATGAAGATGTTCTCGAGAACATCTTCATTGTGTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025523
VALIDATED
NDUFC1 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-125s21c1
Sequence:CCGGCCAGTCAATGCCAAACCTAACCTCGAGGTTAGGTTTGGCATTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-113s21c1
Sequence:CCGGTATGTCCGGGAGCCAGTCAATCTCGAGATTGACTGGCTCCCGGACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-198s21c1
Sequence:CCGGTCATCCAAACACACAATGAAGCTCGAGCTTCATTGTGTGTTTGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-237s21c1
Sequence:CCGGGAAGAAATGGATTGGAATAAACTCGAGTTTATTCCAATCCATTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-96s21c1
Sequence:CCGGCAACACGGTCGAAGTTCTATGCTCGAGCATAGAACTTCGACCGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-197s1c1
Sequence:CCGGCTCATCCAAACACACAATGAACTCGAGTTCATTGTGTGTTTGGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025523.1-91s1c1
Sequence:CCGGCTCTTCAACACGGTCGAAGTTCTCGAGAACTTCGACCGTGTTGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-130s1c1
Sequence:CCGGCAATGCCAAACCTAACTGGTTCTCGAGAACCAGTTAGGTTTGGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-84s1c1
Sequence:CCGGCGAGCTGCTCTTCAACACGGTCTCGAGACCGTGTTGAAGAGCAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-203s1c1
Sequence:CCGGCAAACACACAATGAAGATGTTCTCGAGAACATCTTCATTGTGTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025523
VALIDATED
NDUFC1 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-125s21c1
Sequence:CCGGCCAGTCAATGCCAAACCTAACCTCGAGGTTAGGTTTGGCATTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-113s21c1
Sequence:CCGGTATGTCCGGGAGCCAGTCAATCTCGAGATTGACTGGCTCCCGGACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-198s21c1
Sequence:CCGGTCATCCAAACACACAATGAAGCTCGAGCTTCATTGTGTGTTTGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-237s21c1
Sequence:CCGGGAAGAAATGGATTGGAATAAACTCGAGTTTATTCCAATCCATTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025523.1-96s21c1
Sequence:CCGGCAACACGGTCGAAGTTCTATGCTCGAGCATAGAACTTCGACCGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-197s1c1
Sequence:CCGGCTCATCCAAACACACAATGAACTCGAGTTCATTGTGTGTTTGGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025523.1-91s1c1
Sequence:CCGGCTCTTCAACACGGTCGAAGTTCTCGAGAACTTCGACCGTGTTGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-130s1c1
Sequence:CCGGCAATGCCAAACCTAACTGGTTCTCGAGAACCAGTTAGGTTTGGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-84s1c1
Sequence:CCGGCGAGCTGCTCTTCAACACGGTCTCGAGACCGTGTTGAAGAGCAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025523.1-203s1c1
Sequence:CCGGCAAACACACAATGAAGATGTTCTCGAGAACATCTTCATTGTGTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002494
VALIDATED
NDUFC1 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-217s21c1
Sequence:GTACCGGGAAGAAATGGGCTGGAATAAACTCGAGTTTATTCCAGCCCATTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-241s21c1
Sequence:CCGGTTGAAACACTAATGTAGTATGCTCGAGCATACTACATTAGTGTTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-166s21c1
Sequence:CCGGTGTGGATCTATCTCATCAAACCTCGAGGTTTGATGAGATAGATCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-115s21c1
Sequence:CCGGCCAAACCTGACTGGCTGAAAGCTCGAGCTTTCAGCCAGTCAGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-71s21c1
Sequence:CCGGCCCTTCAGTGCGATCAAAGTTCTCGAGAACTTTGATCGCACTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002494.2-177s1c1
Sequence:CCGGCTCATCAAACAACACAATGAACTCGAGTTCATTGTGTTGTTTGATGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002494.2-161s1c1
Sequence:CCGGCTTCTTGTGGATCTATCTCATCTCGAGATGAGATAGATCCACAAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002494.2-128s1c1
Sequence:CCGGGCTGAAAGTTGGGTTCACCTTCTCGAGAAGGTGAACCCAACTTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002494.2-81s1c1
Sequence:CCGGCGATCAAAGTTCTACGTGCGACTCGAGTCGCACGTAGAACTTTGATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002494.2-68s1c1
Sequence:CCGGCGGCCCTTCAGTGCGATCAAACTCGAGTTTGATCGCACTGAAGGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002494
VALIDATED
NDUFC1 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-217s21c1
Sequence:GTACCGGGAAGAAATGGGCTGGAATAAACTCGAGTTTATTCCAGCCCATTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-241s21c1
Sequence:CCGGTTGAAACACTAATGTAGTATGCTCGAGCATACTACATTAGTGTTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-166s21c1
Sequence:CCGGTGTGGATCTATCTCATCAAACCTCGAGGTTTGATGAGATAGATCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-115s21c1
Sequence:CCGGCCAAACCTGACTGGCTGAAAGCTCGAGCTTTCAGCCAGTCAGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-71s21c1
Sequence:CCGGCCCTTCAGTGCGATCAAAGTTCTCGAGAACTTTGATCGCACTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002494.2-177s1c1
Sequence:CCGGCTCATCAAACAACACAATGAACTCGAGTTCATTGTGTTGTTTGATGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002494.2-161s1c1
Sequence:CCGGCTTCTTGTGGATCTATCTCATCTCGAGATGAGATAGATCCACAAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002494.2-128s1c1
Sequence:CCGGGCTGAAAGTTGGGTTCACCTTCTCGAGAAGGTGAACCCAACTTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002494.2-81s1c1
Sequence:CCGGCGATCAAAGTTCTACGTGCGACTCGAGTCGCACGTAGAACTTTGATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002494.2-68s1c1
Sequence:CCGGCGGCCCTTCAGTGCGATCAAACTCGAGTTTGATCGCACTGAAGGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002494
VALIDATED
NDUFC1 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-217s21c1
Sequence:GTACCGGGAAGAAATGGGCTGGAATAAACTCGAGTTTATTCCAGCCCATTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-241s21c1
Sequence:CCGGTTGAAACACTAATGTAGTATGCTCGAGCATACTACATTAGTGTTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-166s21c1
Sequence:CCGGTGTGGATCTATCTCATCAAACCTCGAGGTTTGATGAGATAGATCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-115s21c1
Sequence:CCGGCCAAACCTGACTGGCTGAAAGCTCGAGCTTTCAGCCAGTCAGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002494.2-71s21c1
Sequence:CCGGCCCTTCAGTGCGATCAAAGTTCTCGAGAACTTTGATCGCACTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002494.2-177s1c1
Sequence:CCGGCTCATCAAACAACACAATGAACTCGAGTTCATTGTGTTGTTTGATGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002494.2-161s1c1
Sequence:CCGGCTTCTTGTGGATCTATCTCATCTCGAGATGAGATAGATCCACAAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002494.2-128s1c1
Sequence:CCGGGCTGAAAGTTGGGTTCACCTTCTCGAGAAGGTGAACCCAACTTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002494.2-81s1c1
Sequence:CCGGCGATCAAAGTTCTACGTGCGACTCGAGTCGCACGTAGAACTTTGATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002494.2-68s1c1
Sequence:CCGGCGGCCCTTCAGTGCGATCAAACTCGAGTTTGATCGCACTGAAGGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)