EMAIL THIS PAGE TO A FRIEND

NDUFC2

NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa

63 Gene Product Result for
Synonyms: B14.5b CI-B14.5b HLC-1 NADHDH2
UniProtKB ID: O95298, E9PNU8, E9PRB2, Q549M5, Q6FIH8, Q9UBJ9
Gene ID:
Mouse(68197) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2
Rat(293130) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2
chicken(404751) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
dog(476794) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
cow(338046) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
domestic cat(101080736) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
domestic guinea pig(100735918) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
naked mole-rat(101717191) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
sheep(101109923) NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004549 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024220 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024220 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024220 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004549 Rosetta Predictions human pricing
NM_001009290 Rosetta Predictions rat pricing
NM_024220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034482 predicted 486
2 SASI_Hs01_00034483 predicted 890
3 SASI_Hs01_00034484 predicted 640
4 SASI_Hs01_00034485 predicted 954
5 SASI_Hs01_00034487 predicted 907
6 SASI_Hs02_00337862 predicted 717
7 SASI_Hs02_00337863 predicted 588
8 SASI_Hs01_00034489 predicted 576
9 SASI_Hs02_00337864 predicted 915
10 SASI_Hs02_00337865 predicted 1310
11 SASI_Hs01_00034480 predicted 398
12 SASI_Hs01_00034481 predicted 596
13 SASI_Hs01_00034486 predicted 1007
14 SASI_Hs01_00034488 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074945 predicted 208
2 SASI_Rn01_00074946 predicted 337
3 SASI_Rn02_00199510 predicted 232
4 SASI_Rn01_00074947 predicted 326
5 SASI_Rn01_00074948 predicted 215
6 SASI_Rn01_00074949 predicted 326
7 SASI_Rn01_00074950 predicted 326
8 SASI_Rn01_00074951 predicted 245
9 SASI_Rn01_00074952 predicted 201
10 SASI_Rn01_00074953 predicted 206
11 SASI_Rn01_00074954 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074280 predicted 283
2 SASI_Mm01_00074281 predicted 245
3 SASI_Mm01_00074283 predicted 274
4 SASI_Mm01_00074285 predicted 286
5 SASI_Mm02_00327591 predicted 248
6 SASI_Mm01_00074286 predicted 282
7 SASI_Mm01_00074287 predicted 288
8 SASI_Mm01_00074288 predicted 251
9 SASI_Mm01_00074289 predicted 283
10 SASI_Mm02_00327592 predicted 255
11 SASI_Mm01_00074282 predicted 231
12 SASI_Mm01_00074284 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004549
NDUFC2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-260s1c1
Sequence:CCGGCCGGCCTGATTGATAACCTGACTCGAGTCAGGTTATCAATCAGGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-225s1c1
Sequence:CCGGGCGGCTCCTCTACATCGGCTTCTCGAGAAGCCGATGTAGAGGAGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-321s1c1
Sequence:CCGGGCTTCTATATATTACGGCCTTCTCGAGAAGGCCGTAATATATAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-399s1c1
Sequence:CCGGCCGTGAAATGTTTGGATATATCTCGAGATATATCCAAACATTTCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-370s1c1
Sequence:CCGGCGTGAAGACTACCTGTATGCTCTCGAGAGCATACAGGTAGTCTTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004549
NDUFC2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-260s1c1
Sequence:CCGGCCGGCCTGATTGATAACCTGACTCGAGTCAGGTTATCAATCAGGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-225s1c1
Sequence:CCGGGCGGCTCCTCTACATCGGCTTCTCGAGAAGCCGATGTAGAGGAGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-321s1c1
Sequence:CCGGGCTTCTATATATTACGGCCTTCTCGAGAAGGCCGTAATATATAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-399s1c1
Sequence:CCGGCCGTGAAATGTTTGGATATATCTCGAGATATATCCAAACATTTCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-370s1c1
Sequence:CCGGCGTGAAGACTACCTGTATGCTCTCGAGAGCATACAGGTAGTCTTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004549
NDUFC2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-260s1c1
Sequence:CCGGCCGGCCTGATTGATAACCTGACTCGAGTCAGGTTATCAATCAGGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-225s1c1
Sequence:CCGGGCGGCTCCTCTACATCGGCTTCTCGAGAAGCCGATGTAGAGGAGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-321s1c1
Sequence:CCGGGCTTCTATATATTACGGCCTTCTCGAGAAGGCCGTAATATATAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-399s1c1
Sequence:CCGGCCGTGAAATGTTTGGATATATCTCGAGATATATCCAAACATTTCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004549.3-370s1c1
Sequence:CCGGCGTGAAGACTACCTGTATGCTCTCGAGAGCATACAGGTAGTCTTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024220
VALIDATED
NDUFC2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024220.1-292s1c1
Sequence:CCGGGCTTCTGTTCGTTACGTCCTTCTCGAGAAGGACGTAACGAACAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024220.1-302s1c1
Sequence:CCGGGTTACGTCCTTTGTCTTTGCTCTCGAGAGCAAAGACAAAGGACGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024220.1-306s1c1
Sequence:CCGGCGTCCTTTGTCTTTGCTGGATCTCGAGATCCAGCAAAGACAAAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024220.1-370s1c1
Sequence:CCGGCCATGACATGTTTGGTTATATCTCGAGATATAACCAAACATGTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024220.1-368s1c1
Sequence:CCGGGACCATGACATGTTTGGTTATCTCGAGATAACCAAACATGTCATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-437s21c1
Sequence:CCGGGCTGAAATTCTTGAGCCATTCCTCGAGGAATGGCTCAAGAATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-302s21c1
Sequence:CCGGGTTACGTCCTTTGTCTTTGCTCTCGAGAGCAAAGACAAAGGACGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-292s21c1
Sequence:CCGGGCTTCTGTTCGTTACGTCCTTCTCGAGAAGGACGTAACGAACAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-207s21c1
Sequence:CCGGACATGGGCTTGTTGGGCTACTCTCGAGAGTAGCCCAACAAGCCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-368s21c1
Sequence:CCGGGACCATGACATGTTTGGTTATCTCGAGATAACCAAACATGTCATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024220
VALIDATED
NDUFC2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024220.1-292s1c1
Sequence:CCGGGCTTCTGTTCGTTACGTCCTTCTCGAGAAGGACGTAACGAACAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024220.1-302s1c1
Sequence:CCGGGTTACGTCCTTTGTCTTTGCTCTCGAGAGCAAAGACAAAGGACGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024220.1-306s1c1
Sequence:CCGGCGTCCTTTGTCTTTGCTGGATCTCGAGATCCAGCAAAGACAAAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024220.1-370s1c1
Sequence:CCGGCCATGACATGTTTGGTTATATCTCGAGATATAACCAAACATGTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024220.1-368s1c1
Sequence:CCGGGACCATGACATGTTTGGTTATCTCGAGATAACCAAACATGTCATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-437s21c1
Sequence:CCGGGCTGAAATTCTTGAGCCATTCCTCGAGGAATGGCTCAAGAATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-302s21c1
Sequence:CCGGGTTACGTCCTTTGTCTTTGCTCTCGAGAGCAAAGACAAAGGACGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-292s21c1
Sequence:CCGGGCTTCTGTTCGTTACGTCCTTCTCGAGAAGGACGTAACGAACAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-207s21c1
Sequence:CCGGACATGGGCTTGTTGGGCTACTCTCGAGAGTAGCCCAACAAGCCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-368s21c1
Sequence:CCGGGACCATGACATGTTTGGTTATCTCGAGATAACCAAACATGTCATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024220
VALIDATED
NDUFC2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024220.1-292s1c1
Sequence:CCGGGCTTCTGTTCGTTACGTCCTTCTCGAGAAGGACGTAACGAACAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024220.1-302s1c1
Sequence:CCGGGTTACGTCCTTTGTCTTTGCTCTCGAGAGCAAAGACAAAGGACGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024220.1-306s1c1
Sequence:CCGGCGTCCTTTGTCTTTGCTGGATCTCGAGATCCAGCAAAGACAAAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024220.1-370s1c1
Sequence:CCGGCCATGACATGTTTGGTTATATCTCGAGATATAACCAAACATGTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024220.1-368s1c1
Sequence:CCGGGACCATGACATGTTTGGTTATCTCGAGATAACCAAACATGTCATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-437s21c1
Sequence:CCGGGCTGAAATTCTTGAGCCATTCCTCGAGGAATGGCTCAAGAATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-302s21c1
Sequence:CCGGGTTACGTCCTTTGTCTTTGCTCTCGAGAGCAAAGACAAAGGACGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-292s21c1
Sequence:CCGGGCTTCTGTTCGTTACGTCCTTCTCGAGAAGGACGTAACGAACAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-207s21c1
Sequence:CCGGACATGGGCTTGTTGGGCTACTCTCGAGAGTAGCCCAACAAGCCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024220.1-368s21c1
Sequence:CCGGGACCATGACATGTTTGGTTATCTCGAGATAACCAAACATGTCATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)